Description :
From Genome Similarity Track
Location :
Scaffold_5:177378- 180953
Transcript NameFunction/comments
Physo_509394AlNc14C13G1599
Physo_417432PREDICTED: uncharacterized protein LOC100206750

Sequence
3575 bases(100 bases per row)
GTGGCACCGTTTGAGCTCAGCTCTGCGGCGAATGCACCCGCCGCCAGCACGCAGCGCTGCTTTGCTCCGATGATGTCCCTTCGGAAGCTGGGCCACGCTA
CAGCCTTCTCGTCAGGGCGATTCCATGGACCAGTAACTGCTGCGAGAGTCACTTCTCGCAGTGCAAGCTTGTGATGACGCCGCAGCGCTCGTCTCTCCTC
CCTATTAACTTCGAGATGATCGCGGTTTTGGTACTGGGACGCCCACAGTCCAATGGGCATTGAAGTTGCTGATAATTAGTTGCGGTAATGGCAGCTCTAG
CTCAATATATAAATACCTATTGTGCAGTTTTTTATTATTGATCTTTCACCATTTATTAAGTATCGTTGTAAGACTTGGGCATCCTTTGGTTTTTTGTAAT
GTCCGGGCACTGTTTCTGTCTTTCGACATCGGTTGATTCGGCAGTTTGAAAGCTATGTTGCGCACATCCACTGGGTCGACCATCGACCTTGTCTCGGTAC
GTACAAATATTTCGGACGAGTTCCGTGTATTTCCGATGATATTAAAAACTACAATCAGTGAGTGATCAAGGTTCCACATCATTTAACACGGGAAGTATTA
CTTATATTAAGAAGCCGCATACATTGCTCTCGATGAATGCTACTGGGATCGGATATGCTTCACTTTCTATGTTCTCTACGTAGTTTGTCCACCTCACCAG
TCCACTTCCTAAACTGGTCAATATTTTTAGCAGGACGAGGAGTAGAGCATGAACGTACCAGGAATTGCGACCTGGGGGGGGCTTCTCAATTTTTTTCCAT
TGAGACGCACAGGAAGCCGATTAATAATCATGAACTCGGGTCAGGTCGGGATACATCTGCGCCTATAATAAACCATCTTCTAGGCTGATTGGGCAATCGC
AGGAAACGTCGAAAATCCCGTGTCTGGCACTAATTTCTCCTACACATCGTGAAAGCGACTTTGCTGAATGCTTAAAAGTTGGGTAAAGCAAGAGTATCGA
TACCGCACGCTTGTTTCCTACTACCGGGAATACTCTTCGTGGATAGGTTGTATCTCTTTGCCATCACAGATCCCGCTGCATTGGCTAACGGGGGATCTTC
TCTATCAGAACGGTTTGATAGATCAGACTCGCCTTGAGTTGGCTCTATTATTTCATCTTCGATATAATCAACTGCGGGGCTACTTTCAAGGCAAATCCCA
GGTAGATGCGAGTCGTCATCCCGAAGCTCAACTGCTAATGGGACTAAATCCCATTCCGAACGCACAGGCTGTAGGTCGTTATCGTCACAACTGAAAATTG
CTCGATCCGGGCTTGCAATATCGCTGGTATCTGATTCGAAACCGGTAGCATCATCATGTATGTGCTCGTTAAGATTCACTTCCCATTTCTTCGTAAAATC
ACTGAGGATTGACCTTAGATCCGCAAGGCGCTCGTAAAAACGATGGGAGGGCAAATGTTGCATGTCGGTCAGCACTGGGAATAATTCTGCTTGAAGGTTA
TTGTATTTCTCGCAGTTAGAGAGAACGGCTTGCTCAAACTTACGTGGCTGAGTTGCGCGAGATGTCCAATTGAGTTAGTCACCCCAGGATTTCTCAAAAC
GTAGCCACCAATTGAGTTGAAGAATTCTAGCAAGACCAATGCTTGATGCTGAAAAAATAACTTTCAAATACTTGAACATGCTGCATTTTCTCCGGAAAAG
CTGTCTGATCTGACCACAACTAGACTCAATCCGATTGGTCGTGATGTTACCAGCAGTAAATCGTTGACGACGTCCATAGTTACTCCAGCGATCGCTGCAG
TTATCCCAGCATCGGCGAAAGTACGCCAGGAAAGTGGGACTTATCTCCGAAACACGCTTTTCAAAAACTGCCAAGCGAGCGTTGTACCGGATGCATACAT
CAGTGAGCTCTTCGACATCATCACGTAGTTTTAAAGGCACAAAGTACCCTCGCCTACGAAGTATCTGGCGAATGTAGCGCAAAGCGTGAAATGGCACATA
AAATACCGAGGCTTCTGGGAATTATGCTGACAATGCGGTCATCTCATCTCGGAGCACCAGTGGTTTGAATTTATGACACGTACCAAAATAAAACCTACGT
TGTTAGTGTTGTGGGTCCAGTCTAGAACGAGTGTATCTAAGCAAGAATCTCTGAGCGACACTTTGAACGACAATACCTACTGTCAGATCCCAGTCACCTT
GTATAAAAAGATATTGGTTGCCTTTGTGCACGAATACAGCAATTATAGTTTTAAGGTGATCCTCTGAGGTGGCGGATCCCAATTAGATTTCAAATCTGTT
GTGGAGCGAATGCTATTGTGAACATGCCTATTTTGATCGCAAACCAATAGATTGACACCCTGATTTAGCTTGATCGATATGCACATCGACCGCGTCCTTG
CGATACATATGGGAGTGTGTGTGTGCAGATTAGATGATCGAATTTTGGGAAACCAGTCGATATAGACGCGTTCGGAGCAGAATTCCCACCTTTTACTGGG
CAATAGTGTAGTCTGGTGATGCATATGGATCGCAACCGATTTAAACCCTGATTTGTACTCTTGCATCAGGTGGGCGTTTTAGCCGGTTCTTACAATAACC
CTAGCGTAATAAGAATGGATAAGCTCAACAATTCATAAAATGCCAAAGCTTCATCCATCAGATTAATATCTAGCGTACCTGTTTTCGCGATAAAAAATCT
GTTATCTGCTTCATGTTATTTTTGATTTTCACAAACGCGCCGAGCTGATCCAGTATTTCGTCTGAGAAGATGGCTTTGCTCTTTGATAAGGGCTACGAAC
GACGCCTCGGTGAGGTTGTAGTTGTGGGAGCAGAACTGTAAATAATGCGTGTCGAAACGTGAGTTGAAGATACTATGATATCAGACATATTGTTGCTCAG
TAAGACACGTAAATCAGCTGTAGTTTTCACAACCCATGTAGGCTCAGCTGTAGAATTTGGGTCTTGAAGGCTGGTACGACAGACCTCTGCCCCAAAAACT
CCTTTGCACTCGCGATATCTCGACGCACGCGTTGCTCGCTTCCCTGTTCCACGCGAGGGCTACTTACATCCCAGAGTGCACATGTATTTCGGAAACGCAA
GTTTTATTGCGGTGGCACTGTCCCAGTCTTGAACTTGGAATTCCATTTGTTGCACGAGTTGGAGTCACGAACTCGATAGCACATCAAATGCTTTTTTTGG
AACTTGCTCCAAAATTCTTCTAGCTTTTCCCAAGTTAAAATTTCCTTACCCGACACGGAAGGAATTTCCCGGGAAATTTCTGTAGGGAGAAAATACAAGC
AGCAGCATAAATTCAGTTAGATAGTACTGCATACTTGAAAAAGCTGCCTACCTCCTGCTTGACGGCTATGCCTACCCACGCCGCCACCAAAACCAGGCTT
GACTACTTTATCACTGCTGTCTTCATCATTTGCATTGTCATCCTCGACGCGCTCTAATATTCAGTAAAACATTGTAAACAACCTAAACATGTGATTAATC
ATGAACGTTTGGACTTACGCCGCCTCTCGTCCCAGTTGGAGCCTAACATGTGCAGGTATATATTTAAGTATATAT