Description :
From Genome Similarity Track
Location :
Scaffold_311:17734- 21331
Transcript NameFunction/comments
Phyag_g4546hypothetical protein PHYSODRAFT_491321
Phyag_g4547hypothetical protein PHYSODRAFT_491321

Sequence
3597 bases(100 bases per row)
CGCACTGTAGATATTGCAGCAACTGACAATAACAGTCGTAAAAAACTCAAGTCGGAAGAGCAGAATCACGTTCCGACTCACCCGCCAACAGCCAGCTACG
TGCTCGTGGGCTTTCAGGGCAAAGAAGGCGCGTTCTCTGAGGTGGCAGCCAAGACggcgttcgaggagctgcgtgcggCCAACGTACTGACGCCCAACGA
CTTTATGACGGTGGGGTTATCCCATATGACCGACGTGGTGGAAGCTGTGGAGAGAGGAGAGCTGGCATTCGGCGTGCTGCCAGTGGAGAACTCGATCTCC
GGCACGTTCCACGGCAATTTGGATCGATTGGTGGCCTCGCACTTGAGGATTGTGGGCGAGGTGGCTTGTGTGCAGGAGTTGTGTCTGTGTGCACTGCCGG
GAGTGGCGATGAACGAGATCAAGCAGCTGTCGtcgcatccagcagtgctggacCATTGCGAGAGTTATATCTGCGCTATGGAGCGGAAAACTGGCCGAAT
CATTGAGCGTAATGCGGCGTGGGACAGTGCTGGCGCATGTCAGACTGTCAAGCAGGACGAAAAACGTCATGTGGCTGCTATCGCTAGtgaacaagcagct
catGCTCATGGACTAGTGGTGCTGGAACGAGGAGTGGGCGATGAACTCAATAGTGAGACGCGTTACATGATTCTCGGACGACTGGATGCAATGCCGTTGC
CATTAGGTGCAGCGTCAAACACTACAAGTCTCCTCAGTGCACGACCACCCACAACCACCAAGTCCAGCATTGTGGTAGCTGTGCCGAACGAACCCCAAGC
ACTTTTCAAGATCGTCTCGGCCTTCGCACTACGCAATGTGATGATCGTGAAAATTGAgagtcgtccagcagctacTGCCGGAAGCCTCTTCACCGCCCAG
ACGACGCACTGGTACGTTGCAGTGCGTTGTTGCTTTTTTATCTCTTCTCGCTATTGACTGCTATCCGTATTGCTGCACTGCAGGGACTACATTTTTTACA
TCGACTATATCACGAGCCAGGACCCGGCACAGGAAGAGAGGCTGCGTGTCAATTTGGAGGAGTTCGCGCTCTGGGTCAAAGACCTGGGCACGTACtcgag
cagcggcggcaaggcGAGTGTCGAACCTCCACGCTGGAAAAGCGTTGTCAACGCTATTGCCTGTTGAATGTTGTCCAGGAGGACAAGTCGTCcacatgta
gccatctctgATccaaatgtatccatctcgAACGAAACGACACCACTGAAAAGTAGCCAAAAGATCTCAAGCACAACCTGATTGACATGCATCACTCGCC
CGAAGCTTCGTGTTATTCCGTGGAGTTGCTCAAGGATGCGTACGGCCTAGGAATctactttgcagcagcaagtgatgCGTCTCACGCCATTGTGGACACT
CGGGTGCCATTCTACCGTCTTCCGTCAGGAGCTTTGGCTCCTGGAGAAGCCAGTGGAGTCATCACACCCGGAGACTTGCTTCTATCAGTGAACGACAATG
ACGTGTCGACTTTACGCTTCCCGCAGATCgtggagcagcttcgacaagtGCCCAGAGGCCCCGTGACGTTGGTTTTCCAGCGTCAACAGCTCAAACAAGT
GGACGCTTCGCCCGAGACGCAAGTGGAAGCTCCAGAGGAGAATCAGCAGAaggagcaagagcaggagtCAAGTGCAGAGGACAAGGGCAAACCGAAGGGC
TGGACCATGTTCCAGCGACTGAGTGCGACCGCTGCAGCCGTtgcatcgacgacgatgtcaACGTCGTCCACGGATGGGGCGATGGCAATGAGAGAAATGG
AAGGGAAGTTGCGGGAGATGGAGCAGACGCTCGCAAGGGAGCAGAAGTGCCGCTTCTTAGCAGAGAGGAAGAACGTTTTGTATcggaacgagctgctgcg
ggtcAGCCAGGAGAACACGGCGCTGAGAGACCAGTTAGGACAGCTGAAGCGAACGCAGAAGCGCCGAGACACTTTTGTTACGGAATCGCTGCATCTCGCC
ATTTAACACGATGTCCGCGGGCTATATAAGTGGAGACTGGAGCACTGATGAAGGTCACTCCACCCTAATGTAAGTCACTTGGTTGTTCACAGTTAACTAA
CCATAGTTTGACACTAGTAGTTCAGATTTGGAGGATGTCGTAGACGCCGACAAGTAAGTAGTCCACAGCTATTTCCGTCAAACATAGTCAATCGCTTGCG
GTGCCGATCAGTTGAGCAGAatcggcagcatcagcgaAATGGCAGCTTTGGCAGAGGTTAGTGGTCTTCATGGGAATCTTTGTGGCGGCGGGCAATCCCA
GCACAATGACGAAAGAAATGTGGATTCACGTGAAGCGGATGAAGAACTGGGACGATCTTATGTGTGCTCGATGTCTTCTGCTATCGATCTGGAGTGTGTA
GCAGGCGAAAATTACGCTGAGCTCACGCTGAACGTGCAGCGTTATCTCTCTCGCATCGTTGAAGAACTGCACCTCATCAGCGCTTGGAGCTCCAGCGTTT
ACCAACCAGCGGTCACTACCCCCAACTCGATGGAGGGTATCAAGCAAACTGACGATCGCTCGTCCACGGCCATGGCACGACTTGCTGTTGTTACGGACAT
GGAATTGATGCGGCGAGATGTGACGAAAGCTCAGCATGAACTCTTCCAACGATGCACTTCGCAGGTCGCATACCTGCACGATGAAGTATTCGCAGCTGGA
AATCGCCAGGATACACTTTACCATGAGCTAAAGCATCGTGTGGACGACCAAAATACAGCCTGGGATCAGCAGGCCCAGGCAATTCAGGTGCTGGAAAAAG
CTCGCACAGAGAGCCATGCACAGATCTCTGCCATGACCACGACGTTGCGCCAcgtgcagcaacaaacttcGACTTATCCTACAAGACTATCATCCCTCGA
AAAATCTCTAGCTTCGCTGACAAAAATGCAGGCTGCACACGGACGGGAGTTGCAGACATGTCAAGGACGAGTGGATAGTTTGGTAACTACGCATCAAATG
GAGATGGAAGCCACGCGAGGTGCTGTAGAGGGTTCGCTAGCAGAACTACGGTCCGCATATAATCAACTATCTGCAAaagtgcaagtgctgcgatTGGAGA
TGCAGGAACTGAACGAAACTACTCAGAAGCGGACCCAACACTTGCTTAAGCCTGCGAGCTCGGTAGCGACTATTGCGCCGGGAAAATCATTGGTTTTTCT
GACTGGAGCTACAGCACCTCCAAGGCCCTCCTCAGCGACACCACGGACTCCACGATCAGGAGGAAATACTCGCCCAACGCAAATTCCCGCAACCGATTCG
AGTTCGGTTGCACTAGATAGCTTTTTCGGGAATGGTGGTGATGCACTGACGGAGACCGACGTGATGGCTGCACCTGACTGCTTCATATACGCCAAAGCTG
CTCTTCCCTACCCAAACTCGCCCAGTGAGACGACTACCGCAACGAAGAAGTCCGTTGCTACACCGATAAGTACCAGCCGATCGGTGAGCAGCTCTTTTGG
GGCCAACTTGGTGAATGAAATGAGTCTTCAGGACGCCATGGTCAAATTTCTGACGGTGCAGCGGTCCGTGATGAGTGTGCCGCTAGGCTACGAAGAT