Description :
From Genome Similarity Track
Location :
scaffold_506:17734- 19011
Transcript NameFunction/comments
g8857.t1 undecaprenyl pyrophosphate synthetase, putative

Sequence
1277 bases(100 bases per row)
GACGTCTCGCCAATGGCCACCTCGGCTGCGATTCTCTTGCAGGCTCGGACGATCTCACCGCGGGCGCCATAACTGAAGCAGACAGATTCTGGTTAAGGGT
CGGTGGTGGCAATGGACGAGCTATCAAGAGTACAATACCTGACGCAGAGATTGAGGTGGAAGGCGTCGCAATGCTGCGTTTTGCTCTCGACCTCCTTGAT
GGACTTGACGAGGAAGGCTGGCAGTTTGCTGCTGTCGGAGGCCAACACACGCACGCGAATGTTGCGGGTGAGCGCTTCACTGAGAATGTCGTGGATGAAT
CCGTCAACCATTTTCATTAGGGCGTCCACCTCGGCCTTCTGACGCTTCCAGTTCTCTGCAATAGCCACAAACGCAGTTAGTAACCTCCGACAGTCGACAA
AAGACCTGGGATAACTCACCAGTGGAGAAAGCGAAGACGGTGAGAGCTTCCACTCCGGCGTCGATGCACCAGTCGGTGAAGTTCATCACAGTCTTCGTGC
CGTCTCGGTGGCCTTGAGTGCCCGAGCCGTACTTGTTCTTGCCATAGCGGCGGTTGCCATCGATAATGACGGCGATGTGGCGTGGAATCTGTCAACAGCA
ACCAGTAACTTACTCAGTAAGCACTTGATCTCACACAACAGACAGGACAAAACGGACCTTGAGGCGATTTTGCACGAGGGGGTCCGTTTCGGCCATGTTG
GAGGCGCTGTAGTTGCTCGTGGAGTTGGCGACCATAGTCTTGTGCTCGTCCGCGTCAATTGAGGAATGGCTCCGAGATGGGAGAAGTGGCGGTCCGTTGG
CAGGTCGTGACTGAGGAATCTATGGGGTTAGCAAATTCGTTCTCCAACCCTTCAACGCGCGATAGTTCGTCGTCGCCTCGACATGCTGAGCCAACTGCGA
TTGGTTTCCTCTCACAATCCTCACTGGAGACGTGTACCGCCGACATAAATGTACACGAGGCAACCGAGAGCAAAGAGCACTGGACCATGAAGAACAAATA
TTTTACCAAGCAGTGTACATGTATCCATGTACAACCTGCAATGCAGGGCGATCCAAAAGAAATGGTGGGACTATGACGAACAGGCCTCAGAGTAAGGACC
ACTATGGCGCGTACGTGGCGTGAGAAGACACGCATTGTACCACAGGGTAACACGTTCAAGTTGCCTTCAGAAACGATTTCGTCATTTCCACCATGTCTGA
TACAGTACTGGTATCTCAAGGGTTATCCATCCAAACAAACCGAAAAGTATAATCAACCCCGTTGTGGTCGAGGAAGA