Description :
From Genome Similarity Track
Location :
Scaffold_21:177316- 179368
Transcript NameFunction/comments
Physo_132487putative polyprotein
Physo_132488hypothetical protein

Sequence
2052 bases(100 bases per row)
ACGTGAGTCCAGCCGCCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGA
TAACCAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAAC
ACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCTGGCATGGCGTGGCGTACACCATAGACTTGCCCA
AGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAACGGTGGGTGGCCCGGT
GGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACACAGGGGTCCCGTACGAGCCCTGGCCAA
ACTGGGCCTGATACGAGTGGGGCTGCCGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTA
AGACGACAGGTCGGCTCGACGATCCACATGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGC
TGACCAGCACGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGCTGCA
GGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGACGCGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATG
GGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTACTCGTGAAGTGGAGGGGTTACCCTGAGCAGGATAA
CTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCT
TGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATTTTCGA
GTGGAGCTTGCGCTTGCTCACGAGTTGAGTGAACTCGAAGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGTGATCCTCACGGAGTTCTTTGAAC
TCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCC
AGACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACACCGGGTGAC
TTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGAGCCGAGAGC
TTCTCCAACAGCGCTGGCGCACCAGTGCCAGGGTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGG
CAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACC
CTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTC
GCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGGCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGC
TCGGCGACTTCTCGGCCACAACCCCAGCGTCGGCCATGGCGACTTCGTCGTG