Description :
From Genome Similarity Track
Location :
Scaffold_49:17730- 18737
Transcript NameFunction/comments
g6932.t1hypothetical protein

Sequence
1007 bases(100 bases per row)
CTGAACGAGAAGCACAACAAGCGCTACACGCTGGAGCAGCTGCAGGAAATGGGTCTGGGTGCCCTTGCCGAGGCTGAAGATATCCGTCAGGCGACTCTGG
CTGGCGGCCTTGACCTTCGTCCGCTTACGACCAAGGAGATCCAACGTCACCTCGACGACTTCGCCCTGCCGGCTGAGTTCGGCACCCACGGCAAGATCCG
CGGTCTGTCGGGTGGTCAGAAGGTGAAGCTTGTCATCGCTGCTGCGATGTGGAACCGCCCACACCTGCTGGTGCTGGATGAGCCGACGAACTACCTGGAC
CGCGCCGCACTTGGCGCTCTGGCTGACGGCATCCGCCAGTACGCTGGTGGTGTCATCATGATTTCCCACAGTGAAGAGTTCTACAACTCGCTGTGCACGG
AGAAGTGGCTGGTGGAGTCTGGCCGCCTGACCATCATCGGCGAGGCGCAGGAGAAGGAATACCGCGCCGGCGGTGGCCGCAAGGTGGTCGACGAGGAGCC
CGAGGAGGAGAAGAAGGTGGGCAGCAACGTCAACAGCTCCATGAAGCGCACCAAGCTCACGAACCCCAAGACGCTGCGCCCGCTTAGCAAGCAGCAGATC
CGCAAGCTGAGCAAACTGTGTAAGGCTGCGGGCAAGTCGTTCGATGACTTCGTGGACGGCATCACGCGCGAGAGCCCGGAGTGGAAGTGGCTGTAAGCGA
TAGACTTAACTTACTATGGAATCAATAGACGATCAACACTTGGACGTGCAATCCCATTGCTACCAATTTGCTGCCGAGTGTATACGCGATTCATCGTGTG
CCGGTGCTGAAGTTGTACCGTAGATTCTGGGCCGTTTCAAAGTTTGAGTCTAGTTTGGCGTTCTAAATTAAATTGAACTCCCACTGCCGCACGCCCGCTG
ATTTAGGTCCGCCCTCCGATGAGTCTCGCCGTGATGGCTTGATTCATGCTGTCGTCGTCCTCGATCTCAAGCTAACAGTGTCGCCTCCTGTTGCCGCAAC
AGCAGCG