Description :
From Genome Similarity Track
Location :
contig_59:177281- 179743
Transcript NameFunction/comments
g11072.t1hypothetical protein

Sequence
2462 bases(100 bases per row)
TCAGGATAACGCGTCCAGCAACGCTCCAATTCGAGACTCAGCAGCCTCGTGCGATTGGCGTCGACTACCCCATCGCAGCGACCCACCACCCCTCCCCCAC
TACCGGGGCTATTGTCTTCTTTACGGCCTTCCACATCGATTCGCAACCACCGCGTAGATGTGCCGCTAGCGAAATCAAACTCTTGGATATGCCGAGTCCG
GACACGAAGCAATGGAGCAGGCGTCATCCCCCCTCCGCTAGCATCATTCGAATCGCCAAAGCGTTCTACATCGTCCAGAAGGTGGAAAGAGAAGGCGCTG
AACACCGTGATGAGGAAGCGACTTGGGTGCTCAGGCGACACGTCAATCTCGATGGGTCTTCCGCGTGCTTCGGCCGGTCGAATAATCAAGTTTGGGTTCC
CAAGTAATCGGTGCACCACAAAATACGAGTCACCTCCGCTGATAGTCCGAGCGCAGGCCTGCAACAGAGCACTGACAGCACGCACACGCTCCTCCGAAGC
GGCTGCAAATCGCTGGATATGTACATCCAGCACCTCGAAAATGTGCTCAAGGCCACGGTTTTGTTGTTGTTGTTGGCCAGAGGAATCACCTCCGCTCTGC
TCCGGTGATTGCTGCTGCTGTTGCTGCTCGCCACCACCATAAAGTGTATCGTTGATGAGAAATAGTTCAGGAAGGATGTCGCGCAGTGTCTGCTCGAGTG
AGATCGGCTGAGGTCGGGGTAGAAAAATTTGAGCGAAGGTCTCTGCGTGGCGCGAGAAAATCGCCAAGTAGTCCCCGCGCGTCTTGGCTCGTGCAGCCTT
CTTCCGGATAGCAATCTGCTCGGGCGGGTGAATCTCCCAGAGTAATGGATCTGTCTCGCGCAAGTACTGCACACTCCCAAGCTGCTGATACGAAGCCGTC
CAGCGCGCGGTTGTAGTCCGGAGCTCTTCTGCGTCGGCATATTCCACATCCTGCCGTTCTTTTTCAGCTGAAAGCGATAGTGATGAAGACGCCATGGCAG
CTTTCGTTGCTGTTGGGGAACGGAACCGATAGAAAGGGTCTTGCGCTTCTTGTCAGGTGTCGAAAAGGGCCCAAAAGATGAAGAGGAATGTGCTGGAAGC
GTCGATGAAGACCCAGCCGTGGCAGCTGCTAGCTTGCAGTAGAAAGACGCCCGATTGAGCGCTTCAGCCCAGGCACTTACAGCAGCTTCTGTCTCCTCAA
CAACACGCAATTCGATTGATTTTCGCCTACAGACAACAAGGTGAGATCAATGAACGTGGGCTCAATAACAACACGCAACTGAAGTTTCATCATAACGTAC
GGGAACACTTGTTGCGTGAGCCTTGCGGAAAACTTGAGCACCTGTAGCCGACGGTGTGAGCTACCACTAGAAATGCTGAAGGCCATAGCTTGGTCCCCGC
GACCACGCTGAACGAGGGCATGGTCTAGTAATACTGCACCACGCGGGAGCCCATCGGCCTCACTGGCAAAATAATACAGGCGGTTCCCCTTGAGCTCAAA
GTATCGAGGCTGCCATGAGCTACCGAGTCCATGCTGCTTCCGTTTTTTCTTCTTGAGCCAACCCGTCTTTTCCGGGGCAAGGTGGCCACTGAGTCAGTGA
TGCTGTCATCGTCTGCTATAGTAAATTCTCCTTGCAATGATGCGTGCTCCGATGAGCCAGAAGGCTGCGATGATAATGACAACATCGACCACGATAGAGG
CAATGCAGATACCTGTTCACTGCTGTCTTCTTCCTCTTCCTCGTCGTCATTTTGCCCTCGGTCGGTTGATTCGTCTTCGTGTCGTTGCAGTTCTGTATTG
GCCCCGATTGTACCAGGCGAGCCTGTGATGTTGTCGTCATGCTTCTTGTCTGCCATTTGAGCTTGTGAGAGCCGTAAAACGTCGATATCTTCTGCTACCA
ACGTGCTGAATGGGCTCGTTTGAATCGTGATCTCTTTGTCGTCGTCACTTTTATCAAGCTGAATCGGCGATAGTGGTTGTGGAAGCGCTGCGGCTCTGCG
TTTTCGCTATCACCCATGTTGTCAGTTAATGCATCTGCAGCAGATTGGCATAGGAGAGGTGGTGTCTGTGGCTGCGGAACGGGGCCGACAGGCGCAGAAG
TTGAGGAGGCAATCGGCCGGTCATCAGAACGCTTGGAAACGTCAGCTACTGCCTGGTTAATGCGGTGGGCAAGCGTGATATGCTCAGCGTGAAGCTCTCC
CGAACGCGTCAGTGGTAATGATACTGTCACGGCCCAGAGCTGCCGACCAATCCACTGCAGTGACACGTCCGGATTGATAGCACCATTGCCCGCCGCGGCG
CTACGGTTACTACCAGAGACAGAGGTATCAAAGGCCCATTCTGACACCACCCGTGCAACCTTCGAGACAATGGCAGCCCCAGCCTCCATGGTCCAACACG
TAATGCACGCCTTGAAAAAATCATCTTCACGATACCAGCGCTCCACTCGGGCCTGAGGGAGC