Description :
From Genome Similarity Track
Location :
Scaffold_5:177266- 178340
Transcript NameFunction/comments
Physo_128559hypothetical protein

Sequence
1074 bases(100 bases per row)
CTCGCGCCGGCCCCACCCTGGCATGTTTCGCCTTGGCCTTCATGGCCTTCGCCAACACGTACTCGTCCATCACCATGTCCAAGGTCATGCTGCTCGCCCC
CAGGTCGGTCAACACGTTCGGAGACCTCGGGGAATGGAGCATGGGTAAGACTGGCCGCTGGCTGTGCGTCATCTCGCAAATGGGCTCTTCGCTCTTGATC
CCGTGCGTCTTCTTGATCCTCGGCGGTCAACTGCTCGACGGCCTCTTCCCGGACGCATGGAGCCAAAACACGTGGACCATTTTCATGGCGCTGATGGTCT
TGCCGGTGTGCCTCATTCCCACGCTCAAGGAGGGCTCCGGCGCTGCATTCGCCGGGTGCATGGGCACCATCATCGCTGATATCATTGGCGTATCGGTCGT
TATGTACGGCATGCGCGGCCACCCGAGTGTGCCGTTCCCCGACCTCAAGTTTGAGCAGGTGGCCAACATGTTTGGCAACTTGTCCCTCGCCTATGGCGCT
GGCATTATCATCCCGGACCTGCAGCGTCAGCATAGTGACCCGACCCGCATGCCCCGCGTTGTCGGCGTCACTGTCATCTTCGTGTCGTGCCTCTTCTTGA
TCCTCTCGAGCACTGCGTACTCGGCTGTGGGCTGCCAGATCTCGGGCAACCTGCTCTTCACTATCTACCCGGACAGTGACACGGGTATGACGTCGCTCGG
CTTCAAGCCGCGGTGGGGAGTCGTTGTGATGGCATATTTGTTCATGCAGCTGCACATTACCATCGCCTTCTCGGTGATCCTGAACCCGGCCTTCTACATC
TCGGAGCGTCTGCTGCTGGGCATGCACAAGAAGAAGAACGAGGAGCTCGAGAACGGCTTCGGCTTTGAGGAGTCTGCTACGCCTGCCGACTTGCTGTCGA
AGCACTCGGACCCCGGTTACGCCAGTGTCAGCCACCCGGTTCGTCGCAGCTCCAAGATGTCCTTTGTGTCGGTGGCGGACTCGGAGCGAGTGCACAAGGA
CAACGAAGAGGAGGAAGCTGCGGAGTACACGGGCTCGAACGCGCTCAAGTACGTGGCGCTGCGTATCGCCATCG