Description :
From Genome Similarity Track
Location :
Scaffold_161:17726- 19859
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.14Leucine rich repeat containing 45

Sequence
2133 bases(100 bases per row)
TGCTAGACTTTAGCAACCAGTACTGGGGCGACAAGAAGTGCGTCGACGTTGTGGCGGCCGTCCGGCAGGCAGCGCCAGCCCCGATCCATCTCGACCTTCG
AGGCAATCGGATCGGCGCGGAAGGCGCCAAGGTGCTCGCAGACATGCTCATTTCGCCGCACTCGGTGGCATCTCTTTGTCTCGAGTGGAATAACGTGGGG
TACCTGGACGTCGGCGTCGAGGCGATCGCAACGGCGCTCGAGGCCGACACGAAGCTCGTGGCGCTGGATCTGCGCAACAACAACGTCGGCCCTGAAGGTG
CCAAGGCGTTGGCGCGAGCGCTGCGACGAAATCAAACACTCAGACGTCTCGATCTGCGCTGGAACGAGATCGGTGGTGCCGGAGTGCTCGCGTTTCGTGA
GGCACTACAGACCAACGAGTCGTTGCTGACGCTCGAACTCACGGGTAACAACTGCAGCCTCAAGCAAGTCGACGAGATCGACAAGTTACTGGCCAGGAAC
CAGGCTATTCAAGCCGAGAACCGCGTCGTTGCTCGTCAGGAGCCTGTGCCAGTCGAGGAGAATCCGGCAGGCAGCGAGGTTCACACCGACAAGCTCCTGC
TGCATGTGCTGGCTGAGAAGGAAGAGCTCGAGGCTGCGCTTGGCAGCAGCAAGAAGGAAGGCCACAAACTCGTAAGATCTGAGCGGATGGTGATTGACGT
CTTGGTTTCGCCCTCACGAATTGTTGATTGCGCAGTCCGAGAAGGTGGACGAGCTCCAGTCCCAGCTCGTGCTTGCTCAAAAGGACGCCAGCATCGCCAA
AGAAGACCGCGACAGGTGTCAGCAGCGCGAGATTGACGCCAGGCGCGAGGCTCACGATCTCAAGCTGAAGCTGGACGAGCTTGAAAGCCGCCGCGCGCTC
GAATACGACGAGTACCGCGCGACCCGCGTCGCTCTCGAGAAAGAAAGCGTGCTGGCCTGCGAAAAGCTCCTCCACGCCGAGGCGCTGCATGCCAAGGGTC
TCGAGCAAAAGAGCAAACAGACCGCCGAGCTCGAAGAGCAGATATACAAGCTGCAGAACGAGGTGCATCGTCTCAGCCTCGCACTCAGGTATGTGTTAGT
CACGACATGTACTTGGTTGTTGGACGGCTGGACTAATGCATAGAAGCAGTGCCAAGGATGGCGAGCTGGACAAACTCAGCAAGCAGCTCGGCGATGTCCA
GCGTGACAAGGAACGCAGTGAAGCTGCACTAGTTGCCAAGCACGAGAGCAGCTTGGCGGCCTGCCAGCAGGACCACGAACGCGCTGCCAACGCTCTGCAG
TCCCAGTTGACCTATGCGATGACCTCGCTGGCAGCTGCACAGGAGCGCGTCAAGGAGTTCAAGGACAAGGCGGAAACGCTCCAAGGCAAGTTGCTGCAGG
CTGAGCTGTCCCACGAGCAAGCGTTCGGTGACGCCAAGGCGCAGTGGGCCGCTGAAGCCGAGGACCGAATGCAGCGCACAGTCGGAGCAGTCGAGGCGCA
ACTTGCCGACGTCAAGCGCGCTCGTGTTCACGTGGAGCGCGAGGTGGAGAAACACCTGACGATGATCGCACAGCTCCGTCAGGAGGGCGTCGCTGCGCAG
CAGAGCCACGAGGAAATGGTGCGTGGACTCCGCTCCGACCTCGAGGCTCGAGATCGCGAGCTCCAAGAGCAAAGCGATGCGTGTCGGGCCGCGCAGCTTG
CCCAACACGCCAGCGAGGACCAGTACCAGCTACAGAGCAGAAGATTAGAGGAACAGCTCCGCCGAGCAGAGCTCATGAAGACGGCGTTCGAGGAGCGGAT
CCAGGTGAGTATGCGACGTGTGCAGGGCATATATCTAGTGAGAGAACTGACACCTCGATCGTGATGAAGCGCATGACGGAGGCGGAGAAGACGCGGACAG
AGGAGCTGAGCGCAGCGCTGACAGCCAAGAGCACTGCGGCCGCCGATCTGGAGCGCGCCGTGGCGCGGCTGGAGCGCGAGCAGGCGGCGCAGCAGCTCGA
GCACGACCGCCGCGTGGACGCGCTGGTCGAGTCGCTCGGCGCGTTCCTGCAGGAGCAGGTGCGCACGGCCCGCTCCGCCCGCAAGCAGGTCACGCCAACA
ACAACAGGAGCCGCCGTCGGTCACGGGCAGAGT