Description :
From Genome Similarity Track
Location :
contig_59:177130- 179589
Sequence
2459 bases(100 bases per row)
TCAGGATAACGCGTCCAGCAACGCTCCAATTCGAGACTCAGCAGCCTCGTGCGATTGGCGTCGACTACCCCATCGCAGCGACCCACCACCCCTCCCCCAC
TACCGGGGCTATTGTCTTCTTTACGGCCTTCCACATCGATTCGCAACCACCGCGTAGATGTGCCGCTAGCGAAATCAAACTCTTGGATATGCCGAGTCCG
GACACGAAGCAATGGAGCAGGCGTCATCCCCCCTCCGCTAGCATCATTCGAATCGCCAAAGCGTTCTACATCGTCCAGAAGGTGGAAAGAGAAGGCGCTG
AACACCGTGATGAGGAAGCGACTTGGGTGCTCAGGCGACACGTCAATCTCGATGGGTCTTCCGCGTGCTTCGGCCGGTCGAATAATCAAGTTTGGGTTCC
CAAGTAATCGGTGCACCACAAAATACGAGTCACCTCCGCTGATAGTCCGAGCGCAGGCCTGCAACAGAGCACTGACAGCACGCACACGCTCCTCCGAAGC
GGCTGCAAATCGCTGGATATGTACATCCAGCACCTCGAAAATGTGCTCAAGGCCACGGTTTTGTTGTTGTTGTTGGCCAGAGGAATCACCTCCGCTCTGC
TCCGGTGATTGCTGCTGCTGTTGCTGCTCGCCACCACCATAAAGTGTATCGTTGATGAGAAATAGTTCAGGAAGGATGTCGCGCAGTGTCTGCTCGAGTG
AGATCGGCTGAGGTCGGGGTAGAAAAATTTGAGCGAAGGTCTCTGCGTGGCGCGAGAAAATCGCCAAGTAGTCCCGCGCGTCTTGGCTCGTGCAGCCTTC
TTCCGGATAGCAATCTGCTCGGGCGGGTGAATCTCCCAGAGTAATGGATCTGTCTCGCGCAAGTACTGCACACTCCCAAGCTGCTGATACGAAGCCGTCC
AGCGCGCGGTTGTAGTCCGGAGCTCTTCTGCGTCGGCATATTCCACATCCTGCCGTTCTTTTTCAGCTGAAAGCGATAGTGATGAAGACGCCATGGCAGC
TTTCGTTGCTGTTGGGGAACGGAACCGATAGAAAGGGTCTTGCGCTTCTTGTCAGGTGTCGAAAAGGGCCCAAAAGATGAAGAGGAATGTGCTGGAAGCG
TCGATGAAGACCCAGCCGTGGCAGCTGCTAGCTTGCAGTAGAAAGACGCCCGATTGAGCGCTTCAGCCCAGGCACTTACAGCAGCTTCTGTCTCCTCAAC
AACACGCAATTCGATTGATTTTCGCCTACAGACAACAAGGTGAGATCAATGAACGTGGGCTCAATAACAACACGCAACTGAAGTTTCATCATAACGTACG
GGAACACTTGTTGCGTGAGCCTTGCGGAAAACTTGAGCACCTGTAGCCGACGGTGTGAGCTACCACTAGAAATGCTGAAGGCCATAGCTTGGTCCCCGCG
ACCACGCTGAACGAGGGCATGGTCTAGTAATACTGCACCACGCGGGAGCCCATCGGCCTCACTGGCAAAATAATACAGGCGGTTCCCCTTGAGCTCAAAG
TATCGAGGCTGCCATGAGCTACCGAGTCCATGCTGCTTCCGTTTTTTCTTCTTGAGCCAACCCGTCTTTTCCGGGGCAAGGTGGCCACTGAGTCAGTGAT
GCTGTCATCGTCTGCTATAGTAAATTCTCCTTGCAATGATGCGTGCTCCGATGAGCCAGAAGGCTGCGATGATAATGACAACATCGACCACGATAGAGGC
AATGCAGATACCTGTTCACTGCTGTCTTCTTCCTCTTCCTCGTCGTCATTTTGCCCTCGGTCGGTTGATTCGTCTTCGTGTCGTTGCAGTTCTGTATTGG
CCCGATTGTACCAGGCGAGCCTGTGCTGTTGTCGTCATGCTTCTTGTCTGCCATTTGAGCTTGTGAGAGCCGTAAAACGTCGATATCTTCTGCTACCAAC
GTGCTAATGGGCTCGTTTGAATCGTGATCTCTTTGTCGTCGTCACTTTTATCAAGCTGAATCGGCGATAGTGGTTGTGGAAGCGCTGCGGCTCTGCGTTT
TCGCTATCACCCATGTTGTCAGTTAATGCATCTGCAGCAGATTGGCATAGGAGAGGTGGTGTCTGTGGCTGCGGAACGGGGCCGACAGGCGCAGAAGTTG
AGGAGGCAATCGGCCGGTCATCAGAACGCTTGGAAACGTCAGCTACTGCCTGGTTAATGCGGTGGGCAAGCGTGATATGCTCAGCGTGAAGCTCTCCCGA
ACGCGTCAGTGGTAATGATACTGTCACGGCCCAGAGCTGCCGACCAATCCACTGCAGTGACACGTCCGGATTGATAGCACCATTGCCCGCCGCGGCGCTA
CGGTTACTACCAGAGACAGAGGTATCAAAGGCCCATTCTGACACCACCCGTGCAACCTTCGAGACAATGGCAGCCCCAGCCTCCATGGTCCAACACGTAA
TGCACGCCTTGAAAAAATCATCTTCACGATACCAGCGCTCCACTCGGGCCTGAGGGAGC