Description :
From Genome Similarity Track
Location :
Scaffold_215:17712- 20220
Transcript NameFunction/comments
g4372.t1hypothetical protein

Sequence
2508 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACCTTGAACTCTCGGACAGCACGGCTAGTGCTCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACTTCGTATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTTACTTCGGGTGCTAACCGACTCTT
CGGTCGGTCTCCGAATTCGTTAACGGCTTTGAGTCGGGACACGTGTACCACCGGGTAGAATCTATACCCACTCCGGTTGGCAATTCCAACTCGTACGCGA
ACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGAGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCT
GCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGATCAGATGTTGCTCCTGTCTCCGCCTGTGACTCGTCAGAAGTCTCGGTTTCATCAACA
TTCGGTACTGCAGCTCTCTCGCGCCGTTCCAGCGACTCATTGTGTTCTCTAGCTCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACG
AGATCTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGATGCCGACATCGCTCGCAGCGTGGA
TTGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCC
CAGTCTTGCTGCAGCGGTTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGTTGTCCGTTCGCCTGCGGCCGATAGCTCA
GGGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGAATTAGAGTTGGTGCTCC
GAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACTTTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAATGCGCACTGG
AACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAGCGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTG
GCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATA
GTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCAGTCGTGGCAACTCCGTAGTACTTCTTGAATCATCGTTGTGGGCACCACTAGACG
CATCGTTGTTTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAACACAGTACACCATCCTCGCTAAGCACGAACTTATCGGCCATCTTC
CAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGCGGCGGAGA
TTCGTCTCCGGCGCTCTTCTTGTATAACCACAGGGTCAACATCTTCTGCGTTCGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCGGCTCCCAGCTC
GCTCTGAGCTTCGGTGGTCACATCATTCGCTTCGTCTCGCTCAGCTGCACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCTTC
CTCACTTTTGCTTGGTTTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTACTT
GGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAA
TTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCAAA
TACTTCACTGACCGCAGCTTGGTCGTGAGCTCTCGGTGACGATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGA
TTGCGAGTCTCGAATCTCCAACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCCGAGACGCCATTGTTCATTCCAGCATACTCGGCGAGGTTTAC
CGTGGTAG