Description :
From Genome Similarity Track
Location :
Scaffold_38:177095- 181094
Sequence
3999 bases(100 bases per row)
AGCCGTGCCTTCGACCGCCACATCGGGGAGTCGCAGAGAATCCTCTCTGCTCTTCATAGAGTGACACCACGCGGCTCCGTAACTCGATCAGCGCATCTTC
CGGTGTAGATGCTACAATTGGTCGCTCTTGGTCATCCGACGCTGTAATCTTAAACACCACGCGCGGTCGTTGTCGATGCTGATCATACTCACCATCATCA
GCTTCAACTTCACCCTTTAGTCGGCGGGCACGTCGCTCTTCAATTTCGGTGCTAGAGATCACACATTCATAGAGACAACGTGTCGCCAGGTGACGTGTGC
TCCAGAAAATGCGAGTGCTACGGAATCCCAGCGGGTAAATAGCCGTTCGAGTATGGAAGCTTCCGTTGCCAACAAACACGTGACCAAGAGAGTGAACCGT
CAGCGCACCCAGGCGGTAGCACATCGGACGTGGCTTGATGCCGCGTTTGATCTCGGCACGCTTCTTCTTTTTCAAATCAGACACTGTCACGAGTGGTGGG
TCACTGAATAGACTTCTTCGCGGCTCCGGACGCGGATTAATCACTGGTAGCACATATTCTGGAGCTGCCACAGGTTCGTCACTGGCTGTTTTGTTGTCCT
GCGCGGGGGTCTGCGAATTTTCTTCGCCCGTCTTCTTGTCTGCAGGTGCATCAACACTCTCTTCCTTAATTTCATCAATCGAGGGTGCCTCGGCTTCCGC
AGCACTGTCGGGCGAAGCTGTTGGGAGCCTCGATGTCGTCAAATCTTCATTGACCGGCATCTTGGGTTCACTGTCGTCTGCATTTTCATCGCTCTTGCCT
CCACTATCCTCCGCTGAACTCACCGCGTCCGCAGACTCATTTTCATCAATTGTTACACTCGATGCATTCCGATCAGATGTAGCTGATACTGCGCTGGCCA
TCTCATCGTCTCCGTTCTCAACAGCTTGCGGTTCTTCAGCCTTCACATCAACGACTTGAGGCGTAGCGGCTATTGACAACGGCATTCCGTTAGTAGCCTT
CAGTTTTCGTGCCACGATATCCAAGTGTGGTGCAAATGGGCAGCAAGTTTCACCGTTCGGTAAGAACGCCACTCCAGCATCTACTGCGCACGGAAAGTGG
TAGTGTGTCGTGCAGCGTGCTATGGTACAACCGATAGTGGCTCCCATGAGCCCACATGCGTCGCAGCGAACGAGGCGGCTGCGGTGTTTTGCCTTGTTGC
ACTTATGCAGCACACCCGCCGCGTCCTCGTACACCTCCATAGACCAAATCGCACAATTTACATGCACCCAGGTTTCGGACTCGGTGTAGAGCAGACGTCC
ACACGCAGTGTTGTCGCCAATCATGAAACACAAAGCGCAAAATCGAGAGTCTTCGAATGGTATGGTCAAGGTGCCAGAGGATTCGCTGTCGTCCAAGTCC
TTTTCTCCTTCAGCGCTGGTGGGCCAACCATGTAAGGGACACGCTGTCGTCATCTGGACCATCACACCATGCTTTCCGCGGGACGGTGTGAGCGGCGATG
CTGCTGGCAAAGGTGTCGTGTGTTCTTTGGAGGCAGGTAGCGTGTCAATACTCACTTGAGGCGTAGGCCTCTTCGCATCCGAAGGTGGGTCACCACTTCC
GTCCTTTAAAGAAGGTTCCTTCTCTGTTTTCGATCCATTGTTCGGTGAGGTTACAGTTCCAGTTGCAGCATCACCGGCGCCAAATACCGTGATTTCTGAA
GTAGCTTCGTGCACGAGGTGTCTTTTAGCTACGCGACGATCGTATTGTTCTTTGATCGCAGCGATTTCCTCTTCCAGTTTCAATCGTGGTTTCGTCTCTT
CGCCGTCAACACTCTCACCAGCTCGCAGACGCTTTAACAGCGGCTCTCCCAGTTTGCGTTGTTCAGTTCCAGTCACTCCGTCCTCGTCGCACGATAGCAA
GTGCAGTACAACTTCAGGAAGTGGGCGCCACCCATAGAGAAGATGTACGCATGCCAACAGCGCAGCGCAGCTTGCAGCTTCGGATACAATTGTGCAGATG
GCACTCGCATCCTTGCGAGTGTTTAAGCCGACAGTTTGCTTAGAGTAGAAGCTTTGTGTCTTCCGCTCTTGACGCCGGGCTGCTGCGCGAGGTCCTCGAA
CGTACCGTTTGAACCGCATGTACCGATTGGCCTTGCGCAGTAGCCAATCTGGCAAAGTCACCCCACTCGCATCTAGCTCTTGCTGCTTCGTAAAGCGATA
CCAGTCACTTTGAAAGTTGAGGCTGCGGTACGCGAAATTCCGGAGACATTCCTCTCCAAGGCGCAGCACGTACAAGTAAACAGGCGTGTGGTCGGCCAAA
CGCTTCCACCGCTCAACCTGTTCATGCTGCATGTGCGTCTCCTTCCAGCTGGACTCGCACTGCAAACGCTTACGCTGAATATCGGCAATGAGCACCTGAC
ATCGCCAACCTTCACCATCAGAGGCCTTGCTGGTAAGGTGCGCACGTTCCTGGGGACGGCACGCAGCACACACGTACACAGCATTGGGATCGTCCACGAG
GATCTGGTACCGCTTAGGTTCAGCCTTCAGCAAGGCATCGCACGGAGGATGCACCCAACGCTCACAGGCATCACACTGCATAAGTTCTTCGGAGTCGGCA
TCCCATTTACGTCGACAGAGTGGGCACTTTTCAGCGTCCTTCTTGTTTTTGCGCGCAGCTTCGGACCACACCTCCGTCAGCAGTCGGGTCTTTTCCTTGA
GAGCTTCCGCCTCGCGCTCTCGGCGGTTGTGGCAGTGCAAGCACTTATTTCGTTCGTAGCTGTAAGTGCGCTCGAGGGTCGCGAGATGGTCCTTCTTAGC
CTCTTCAGAATGCAGGTGCTCCACGCTATTCTTCTTGGTATCCTCGCAATTTGTGCATGTTACGCAGCTTGCGCAGAAAATTGTGAGGGTATCGCCGTCG
CGCTTCTTCGAATTCGGCAGCTTAATAGCTGGCACTAGGCAAGAACCGTGGTAACCACGATCGCAATTCGCGCACAGTAAAAGTGGTTCACTGATAGAAA
GCTCCAGGGAAATGTCCGCCTCCACTACACCACTTGCTGTAGGAGTAGGAGGAGCTGGGCTGTCGATACTTCCTGCTGTTGCAGGTACGCGGCCGGGGTT
GCCTTCAGCCCCACAAACGGCTCCAGGTTGACCACATATTTCGCACATTTTGCAGTTCGGACACCGCCAGTAAGCACGAATCTGGTCGTTGCCTTCCATG
CGGTCAATGCCCATACCGGGAGCGCAGAATGAGTGGAACCCTTCGCCGCAGTCAACGCAGAAAATAAAGTCGCTTTGCAAGCCAGCACTGCCGCACACAG
CACACATATCCAACCAGCTGTATGTATGAGCTGAAGTGCGCGTCTGTACGAGCTGGAAGAGCGGGACGCGCGAGATCGAATTGCCAGCGCGGAGTTTTGT
CTGGAATATCAGCGCATCATTCGTGATAATTCGTCGGTCACCGAGCGCTGTGCTCACGGCGGAGATTGATCCATTAGCTGTTCCAGCCGAACTAGCGGTA
CGAGTTAGCTCTCTTCGCTGATTAGTTCCTGCTGAATCCGGTAAATTACTGCTTGCATCACTGTCGTGCACTGATGCTGCATCTGATGCCATGGCACTTG
CTGACCCAACGGAAGAGCCTGCATTTTCTTGCTGGCCATTTCCTCGTGTGTTTGCTTCTGATCCCGCATCTGAGCCATTGTCGCCATCTTCATCATCATC
AAGGTCGTCATCATCGTCGTTGTCTCCACCATCGCCGTCATTCTGGTTTGCCTCAACTGAATCACCATCCGCTTTTCCAGCTAGTGCTGAATTGTTAGGC
AACTGCCGCTTCGCTGCGACTAACAGGGCATCGTAATGGCGTCCTCCGCGCTGCTTCATGCGAGCCTTGGGTGCCGTTTGGCGGAAAATTCTCTGTCCTT
GGCCGTAGAACCTCCAAGCCTCGCGCCAAATCAAGAAATCGCGTTCCTTCGAGTTGAACGTGACAGCGTTCAGGCACATTAACTCGAAATCGTCACGGA