Description :
From Genome Similarity Track
Location :
Scaffold_27:177062- 178514
Transcript NameFunction/comments
Aphas_H257_10737Drug/Metabolite Transporter (DMT) Superfamily

Sequence
1452 bases(100 bases per row)
GGCGACGCGTACAACGGGGACTTGAGCACGCGGTCCTTGCCCACCCCTTGCTCTTCCTTTTCAGAATGGTACACGACCATCCCAAGCTACGAGACCCCAC
CACTTAGAAACGAACGACATGGCAACGACCTACGATGATGATGAAGAGGGCAAACCCATCAAAGATGGTAAACTTCTGCGCAGCCAACGGTCCCGCCAAC
GCTGGCACCATGTACAAGATGTCCGTGAGGGGCAAGCACACGGCCGACGAAATCACAAACAGCACCGAGCTGCCTTCTTTGAACACGAACATCATCAGCT
ACACACGCATATGTCAACCACCACGGTATTGCTACACAAGATGGGAGTACTGTACCACGTTGAACACGATGTTGAACACAATGTACTGGATGTACGTGGT
GAAGATATCCCCGCCGCACGTCGACGTGACGCCGTTGAACGTCGTGGGGGTGCCAAAGAAGCAATTGTGCGCCGATTCCACATACGACGGAAAGTCATGC
CACGCCACCGTCGGGTCTGAAAATGCAGGCAGCTACATCCGACTAAGTATTTCGCCCCGACAGAACATGAGCAAAGACGACGTACTCGAATGGTCCAGAC
CGTCAGGAGCCCCCAGCCCACTTGGTAAAAGCTGATCCAGGCGTTGGCGTACCAAATGTCCAAATCCACGTCTTTCAAGCCGATTTCCTTGTACACTGTT
GATGCAACTGAGCTTTAGTTCTGGCATGAGGCGAAGGAACGCACCGTTAGCACCCGCAGACGGGATGCACGACACCACGTAGAGAAGGATCCAAAGAACG
GACGGATCGGGACTGTTGAGCGCGACGTCCCCGCGGAAGATGGGAATCATGCACACAAACGCGCCGTAGAGCACCATGATCGCACCCACAACATGCGCGC
GCTTGTATTGAGTTTGCAAAAACCAGCGCGACAAGATCATCGTGAATGGTAGACTCACTTGGCCCAACACATTGCTCAAGTTCCCCCTAATTGCAGTCAC
ATGATGATGAAGTGGCTGGGGACATCTGTACATACCCAATGTGAGGAATGGGTACGGTTCCAAGCAAATTCGAGGACATGTCCAAGAAAGACATGACCAT
AAACTTGTAATGCGGCACAGCTTTCATTTCAGGCGTAATGTCCTCTGCTCAAGACATCATCCATTAGCATACAGTACTCCGTTGGGAGAAGGACTTCATG
GCAACGTACTTGTAAAGTAGAGTTTGTACCACACGACGGGCCAGCAAAAGAACTGAAATGCCACGGGGTTGATGATGTTGGCAAAGTACCACAGGTATTG
CGCGTAGTTGTACGTGATGCGCCTGGTTGTTTGGTTAGGTCATGAAGCCCACAGGGTCCTTACGTGTTGTAGACGCGGTCGATGCATCGCGTTAGCACGA
GGAAGACCAATGCGATGATGAGCTTGGACTCTTGCAGCCACTTCTTCACGCC