Description :
From Genome Similarity Track
Location :
scaffold_50:177060- 183816
Transcript NameFunction/comments
g9369.t1hypothetical protein

Sequence
6756 bases(100 bases per row)
GTCACTGCAATGGACATGGGAACCGCTCTTTGCTTTTGACAGGTTGACAGGCAGTAGCGTACTCCGCAGGTTGTGCACTTTTTATTAATAACTCATTGTG
GTGGTAGCAAACGCTTACCCAGGGTCTTGCGCGTGCAGGTACAGCGTGAAAGTGAGCTCCGTTGTCTATGCTTATGATCCTGCTTCCCTGGCTTTTGCAT
TACTACATGCACTGTATTGTACAGACGTTCTTCTAGGTCGTGTAGGTTGTAATGTAAGCAGCTCAATCGAAGGTGCTTAATTAACTATGGAAATTATCCG
TTCGTCCAATGACGCCCCCAAAACGCACCATCGGCCTCCTGCTGCTTGCGGCCAATGGTCAGGGGAAAGTCAGTTCTTGAAGTCTTGTCTCTAGTCACTT
GTCCGTCATCATGATGACGGTGCTCACTCATGAATGTGTTACCTGTATTTCAGGATATGGGCTCAAACTTAATAAAGAAAACATAACATAAAACTCGTTG
AGACAGAGCATATTATCCGGGTTCTACTCGAAATTTCCGCGCGTGGCTGATTCAATCGACCCTGACAAAGTGCTTGACATACTGGTGGACACGGTGCCGC
TGCGCGGGACCTCTACATGTGCCTGCCGGTTATACACAAAGCGCCCGTCATAAAATCCCTTCATCTTACTATGCAGTAGGCATATCCAAGTACGGGCTCG
ACTTGGTAGAAAGCCACACAGTTTGATATCGATCGATTCCCAAATGGCTTGGAAACTATCGTCCTGAATCGGAAGGGTCTCTCGATTCGCTGCATAAGCT
GGTCCTTTCATCACCGCTGTGCTACAGTGCTACGTTATGCGCACCTCGGTGTTCCGATACCGCGTCATATCTGTTTATCGCTGCTGGTGGGTTATCGCCC
ACTATTGTGGCCGACTGCCCGTAGCGCTGCCAGCGAGGACCGGGAAGACGCAAGTCTGGATCGGAAGATAAGCTGGGCGTTATGTTAGCACAAGGATGGC
GACTAGGACGGACATAGGAAGTCGTTAGCGTAGCTAAATGATACCCATGTACCTCACTGAAAAACGAACACTAAAACTTATTGCCCACTACAAAATAATG
CTATAACAATACTCAGCAAACCAGTAAGAAGGCTAGGACAAGGTGAATAACATGTGCAAAGCTGCTATTTCTTATTTTTTCGTTTTTCAGTGGCGTACAT
TGATGTCACTTAGCTGCGCTAACGACTCCCTATGGCCGCCCTAGCTACCGTCCTTATGCCAATAAGTACCCCATGCATTGCATTAGGTAGTTACACTCCG
ATCTGCATGTACCATGATCACTCGAACACTACCAATACGATTGTCAACACACACACACACACACACACACGATCTCCGCTCTGCTTGTGGTCGATCCTGC
AATTGCTACTGTAAATGTTTTTATACGTTTTAAGAGGTTACCCTGTCCACGAAGCCGTGTAGCAATGCACTGGTCCGGATGGTATGGTATGCTGGGAAAC
AGATGCTCAACCTTTCTGGGAAGAATTTACGAGCTGCTCCTTGACCTTTCCAGCTCGAATGGTAATTTCATTCACAAACTTGCCCTCTAGCGCTCCAGTC
GGAGGATGCACCGCTGTTTGCTTATTACGTTGACTATATCGTCCGTGTTTCTAAGCCTCGATGCCAGTGCAGCGGCGCAACATTCTGAACCAAGCCTCGC
CATTGTTTCCAGCTCGCATCGTCTCGTAGTTCCAGACAAGATCGATATTGTCCCTGCGGTGAGATTCTTGAGAGCTGGCCATACGGCGCCTGATGAAGGC
GAAGAGAGAGCGGGGCTCTCCGTGTCCATGGCCGAGAAGGCTAAAACGTTTCTCTCCTCGTCGACAATCTCCACCGAAAAGCTCCAGAAATGGCTCAGCA
GCGGCAAAAATGCAGACAGCGTTTTCTCGCGCATGGAGCTTACCAAGGCTGGGGATGACCTGCTTTCTAACCCACAGTTCTCCGTGTGGATCAAGTACGT
GGATGATTTGAGTGCACAATACCCAGCGGACAAAGCGACTCGGCTCCGACTGCTGACGATCAGATACGGCGATGATGCACTGGTATAAATTCTAGAATCT
GCGAAGAAGCTCCCAGGACGAAGGAATCTGCCACCAGGCTGCAAGCCGAGCAGATTCAGCAGTGGCTGAGCCGTGGGAAAGCCCCTGACAGTGCTTTCGT
ACTGTTCGGTCTCCGAAGAGTCGAGGATAGTTCCTTCTCACATCCGAAGTTTACCTCGTGGGCCACGTACCTGGATAACTTCAATGCACTGAACCCGGAG
AAGGCAACGTCGATGATCCAACGTTCGGCTTACACGGTGAAACATTAAGTTATGTCAAAGATGCTTGATGCCGACAAGACAGTGGACGTAACAAAAGCAT
CTGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGGTGGCTGAGGAGTGGGAATACACCGGACAGTGCTTTCGTACATATGGGACTTGGCGATGTCGGGGA
TAATCTGTTGGCGAGTCCGCTTTTCAGCACGTGGGTCAAGTACCTGGATGATTTCAATGCGCAGTACTCAGCGAAGGAAACAACTCTGTTTCATGTTTTG
ACGAAGAGGTTCAAGGATGAACTTCTGGCAAAGATTATTGCTTTCGGAAAGACACTGGACAGTACGAAGGCAGTGGCGACAAGGTTGGAGAACCAACAGA
GGCAAATCTGGCTGACCAGTGGTAAATCATCGGACGACGTCTTCACGCTGCTGAAACTTGACAAAGCACCAGACAATTTCTTCGACAATCCGCTGTATAA
GACGTGGGGCTCGTACATGAACGTCTACAACAACAAACATCCGGGGAAGCAAACGAACTTGTTCAAGACGTTGACGACCAAGTGCAAAGACAAACCATTG
ATCAAAATCCTCGAGGAGGCGAAGAAGTTTCCGAATCTCGAAAGCACTGCCAGCAAATTGCAGACGGAGAAGATCCAGAGTTATCTCGCCAGCAAGAAAT
CTCCCGATGAAGTCTTCACGCTGCTTGGACTCGGCGATGCATGGGACAATGTTATTGGCAATCCACTGTTCAAGACGTGGCTCACCTACGTGAAAACGTT
CGACCAGGGGAATCCAGCAAAAACCGATTGGTACGTTTGCACTTCATGGGGCCTACGGTGATGGAGGTGTTGAATCGATGGTTCACAAGGGGCTGCAAAA
TCCAAGCACTGTGAAAATTGCTGAAAAGGTGCAAGCAGGACAGCTGGAGCGTTGGCTTGTCAAGGAGAAGTCTCCAGATCTTACTTTCAACTGGATTCTA
CGACATCCCACGGCGGACGAAAAGGTTTTTGCCGATCCACGTTTCGAAACATGGGCCAAGTATCTGGGTGACTTCAACCAACAATACCCCGACAAGAAAA
CGACTATGATCGATGCTTTCAGAGCCAGCTACAACGATCGAGCACTATTGCGAATGTTCGATGCAGCGAAGAAGGTCCCGGGTTCGGAGAAACTGGTCAC
GAACTTAGAGAACGCGCTGCTCGACAAGTGGGTGAGTGCAAAGGAAACCCCGGCAGTACTTTCCAGAAGGTTCAGTGGTGTGGTAGCCGCTGATGAAATG
ATCCAGCGGTACATCAAGAAAGCCGACGCAGCTGGAAACATCGCTTAAGCACTGTACACCAGTACTATTTCGACGCCAATACTTTATACTCTTGTTCAAG
CTTTGGATTTTCGTTCTTTGCAAAAGCTACGCATAAGGAATCATACTGGACTGTAGTGAAGGAAGTTCTTTCGTTGCCGAGGATGTTCGAGAGTCCCGAC
AGCAAACCAAACATATATGAGGGAGGCTGGGGTTTCCTCGTAGGGCCACCACTTCAACAGATACTACGGAGTAAGTACTACTTGAAGTACTACGTAGCAG
CTCTTTGCTTTGAAGTTGTTCACTTAACGCAAAGGGGGGCGTCGTATTCGTGAAGCTGGTCATGAAACTGGCCACGTTGATGTGACGAAGGAACTGGATC
AAAAGTTGTAGCGGTGACGTCTTACTGCAGTAGTTTTCACAATATGGTACGAATATCCCAGGAGTAATTAGCAACTTTATTTTTTACTGCAACACAGGCT
ACGTGCCTTTCAAACACCGTACCCAACGACGACAAAGCTTCAGTTTGTAGTATTGATATGCTACCTTTTTGTTTGGCAGTCGTGTACGCTTTGCGCATGT
ACCCCAAGGTGTTGCTACCGGGTGCGCTGAACTGGAGGGGAACGGAAGTTTGTAAAAGATTGAGGCGAGCATTGAGTTATTTTTTCACAGTACATACTGA
CAGTATGCGTGGAAGTTACGTAACAAAACCAAGATTGAGTGCGCACTGCTGATGTCAGCGCCCTCGATGAAGCGACGTACTCCAGTGGAACAGTGGCTCG
TGTTTGTGCTGTAAGCACCATAGCGTCAACCTTTTTTATGGATTATCTCTCCATATCCAAGTATACTAATGTTTCTAACCGTATACCAAAGCATCATTTC
ATGAGAAGTGCTTGAATTCTGCACAGTTTATCCAAAACTACATAGTAATGTGCTGTCTTCAATGATCTTCTGACACGAAACGAAGTATTTGGTAGCTTCA
CGTTCACTTTAAGTCTTGTCGGGGTAATTTAAAATATGCAAACTACGTGACGCAACCGTCCAAGTCGGAAGGTTACCACCGGTCTGATCCAACTTGAGAG
ACCTGAATACAGCGTCCGATGATTCTCCAGGCTTGGAGTCGGCCCTATCATAGACCTGAGATAATTCGCGGCCGTCTGGAGGCTACAATTCTTCATTCCC
TCTTCGCCGTCCGAGTCTTCGTCGCTGTGGTCGGTTGTTCTGGTCAGCAACGTTCATGGAGGTTGTGAACTTGGGTGTGCAATCTCTGGAGTAGCATCAG
CACTTGTAAGAACGGCGACAGCAATCAGAAACATGAGAATGGAAGGTGCATAGGGGTCCTAAGAGAGCAAATACGATGCCTGTAGCGAAGTGACAAAGGA
TTCGAAGCGGCCGGGAAAATATTCAAGGTTTATGCATTTTAGACGGTCAGATGTTGTATCTACATCACTGGGAGGTAAATTCACGCATTAATCCGTTGAG
TTACTTGGGGAATGGTTAGCACCCACTATAAATGTTGAGTAATAGTAAAAAATGCGATATTCGCTCTCAGATCATTGGTCTACAAAGACCGCAAACAGCA
GAGACCGAGGGTGCGTTTTGGGGGCGTCATTGGACGAACGGATAATTTCCATAGTTAATTAAGCACCTTTGATGAATGATATTCTAGCTGCTTACATTAC
AATCTACACGACCTAGAGGAACGTCAGTATACATGTAGTAATACAAAGGCCAGGGAAGTGACACTATTACATGTATGGCACGTGTGCAGCCAATTGGCAT
CGTTGGTTGGGTCACTACCCAGTCCAGGAAGAAATAAATCGAATCGTGCCCTTCATCGCGGCGAGAAAATCTCCTACTATCACGCCTAATTTTATGGCAG
CGACAATTACAGACTGGTCAAAAGATCTTGAAGACCCATGCAAGTTCTGTGGACTATTTGAACGACGTGCACGCAGTTCATGCTATGAAGAATTCGAAAC
AAAGAAATATTTGACAAGGAAAATGCTCACACCAAAGCAGCAGAGCAGATAGTTTGGAATGCAGCTGACTTTCAAACCATGGCCGTTATCCGAGCTTGGA
CGTCGAAGGCAGAAACTTACGAGCAAGGTTTCCGTCTTGATCAATGCTATATTGTGTTCAAAGAAGTTCCGCCACAAGGCAGGCTATATTTCTGCAGGCA
TAAAGAAATCCACCGAAACGCAAGGAGCTTGGATACTGCTGAGGCCGGACTAAGTAAATTCGACTGGAATTGAAGCAGTAGGTATTCATTCTGTTGCCGA
GTCGAGATCGGAGAGGGTTTTGGCTCAAGAAGTAATTTCTGCAGCCCTTAACGAGATCCGGCAGCTCACTGTCCCCAGCACCGTACACATCATCCTCCAG
GGAACAATCCCATCAACATTTCGCCCCGAGCCCAGAGATATATTCAACAGAATCAACTCATACACGTGAGAAACGACGACGATCAAAGCAGTAGCGGCAG
CAGCCGAATTGATCAAGCTGTCAAGGTCAGACAGAATATCGATGGGCATCTTCAAATTCACCAGCCTACAGCCAAGACTCCAAGAATTGCTGAGAAGCAA
ATGCATTCGGAATACCAGTCCATCCTGGTCACCAGATAACACCGCGATCAGGCTCAGCCTTCAGAAACTACAGGAGACTATAGTTATAACGTAACATAAT
AGAGATTCTCTCTCCCCCCTCCCCCCCTCCTCCACGTTCATAACCTCCACTCTTGCTTGTTCAGATATTGCTCACCAGAACAACGAACCCGCGAAGAGAT
TCTTAAGAACTGACCAGACGGTGGAGAAGGGTGAAGACTCGGACGAAGCGGAGAGACTGTACATACCTGGGCTCGAGACGGCCACGAACTATCTCAAGTC
GATGATCGGGCCGACCGTTGCCAGCCCAAAACAACTCAAGGCCTGGCTCGTGGGTGAAGAATCTTCGGACGACGTCTTCAAGTTTCTCAAGCTGGATCAG
GCCGGAGTCAACCTCCTTACGAACCCCAACTTGGACGGTTGGGTCACATCTTGTAATCGTACAGTTTTTTTTCGTTCCGGTACTTGACCAAGCGGTGGAC
TTTGGGTTAACAAGCAGATTATTATCCTGCTGTGAGCTTCTTCAGACTTATATATA