Description :
From Genome Similarity Track
Location :
Scaffold_48:177010- 179443
Sequence
2433 bases(100 bases per row)
GAGGAAGACTCCCTGTTGAGATGGTATCTCGAAGTGGACGATGTCATAAAGGCTCGCCACATCGACGATGAGGAAATGCAAGTTGCATTTGCCAAATCAA
ATTTTTCAGGGCTTGCCAGAACTTGGGCTCTGAATCTTCAATTACACGATCCAAACGTGTTTGGATTGTTGGCGGTCATAACACGTTGCTCGGCCAAACG
TTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTACAGAGCTCCTGAAGATACAACAAGGTAAGTGTGGCGTTCACGCTTACGCTCAGCACGTTAGTTACC
TTGCGAGTTGCATAGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATAGATGGTCCCGTGAGGAACCACCTATTCCG
CATCGAGTTGAAGCCGCTTGAGGAAGCGATCACAACTGCGGTACAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTGAACCCCTATCTTCCTTCG
AGACGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTCGAGAGAGAAAGACATCGCTCTTCAAGCAGTAAGCGATTGCAAAAGTGCAATA
ACTGTCAGAAGTTAGGACACTATGCCTACGAGTGTAGTGCTTCGCGCCCAGTGTCTCACAACACTGAGCGAAATGATCGGCCGTCTGCCAAGAAGGGCAA
CGGACGCGGGTCCGACGCTGTTGCGGAGTCACAACAGCGTAGCGGACCGTAAAAAAACGGTCGAGGTCAGTAGGGGCGGAGTGCCCTACTGATCCAGCAA
CCTCAAGAGAATTTTCAAACCTCTTGATGAAAGTTGCTCCAGACTCACAATCGTTGTGTGTGTCTGCTTGGTGACGAGATACCCCTCATCACCTTGAATT
TAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCATCGAATTTTTTTTTCGTCGCCAGTCGCTAGAGGATGGTAGGCTCAAGTTT
GTTGAGCGCGACATCCCTCCGACGAGGATGACGGTGCGCCTAGCAACAGGCGCATCGATAACATTGAAGAAGCGCGTAGTGGGACTTCATTACACGCTAG
AAGATTTGTAGTACGATGATGATTTCATCGTACTTGATTTGGATGACAAGTTTGATGTCATCCTAGGTTTGCCTTGGTTCAGAAAGTATGAGCCAAGGGT
CAGCTGGAAGCATCGTACCGTGACGATGCCTGCCACTTGTTCATCAGATGGCTATCTGGTGATCGTATTGGAGCGTCCACAAGCGTGTGGATGTACTGCG
AGCGAGTGCGATGGCCTCACTTGCGTAAAGATCGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGAAAGCTGCCGGCGGCT
GTGCGGATGCACAGGCCGCGCCGAAGGTCCACCACACAAAGAAGTCGAGTGGATGGGGACATTGGTGTAAGCCTAGTGGACGACATCCAAGGAAGAATAA
ACCAGTTACCCACACAGGGAAACACGATGATCCTAGATCGACTGGAGAGTCGATCGTAGAGGACCTATCTGATCGCGCCTCCGAAGTTGAATTCGGAGAT
CAATCAATTGCCAACGCTAGAATCGAAACGGTTCTTGCAAGATCTGCATTGTGGGAAGGTCAAGCAGATATGTGTACTCGTCGGAGACGACGAGCACGTG
GCTGACATTCGGTCGGCAGTAGTATTTGCCGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGAAGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGC
GATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTATACAAGAATTTGATCGAATTTAAGGACGTGTTCCCTGAATCCGTACCATGCAAATT
GCCTAAGGATAAGGCACTCAACATGAAATCGAGCTCAAACCGGGCTCGAAGTACTGTATCATGAAGCAGCGGCCACTGCCTCGTGAAAAAGTTCTTGCGA
TCGACAAGTTCTTTGCCGATCGCTGAGCTGCGGAACATGTGAGGGAGGAAACTTCCCCTCACCGCTCTCCGAACTTATGTGTGCTCAAGGCCACAGGCGG
ATGGCGGATAGTGCACGCATTCAACAAGTTGATCGTTGCAACGGTACCGGCTCAAACGCCGATACCGAGGAAGAACGTAATAATTAATGGTATGTCAAAA
AGTACCATCTTTTCGTCCGTGGATCTGATGGATGGCTTCTATCAGGTCCTAATGCGTGAACGGGACATCCCGTACACAGCAGTAAGCAACCCGTGCGGCA
TGGGTGGGAGCGGCTAGTAATGCCACAAGGGCTTAGTAATGCCCGTGCCACCTTCAACAGATTTGTTACAGATCTGTTGAAACCGTGCGAGACTTCGCAC
CGAGTTACTTTGACGATGTATTCGTTCACAGCC