Description :
From Genome Similarity Track
Location :
Scaffold_79:17700- 19512
Transcript NameFunction/comments
Aphas_H257_16260PREDICTED: tetratricopeptide repeat protein 18

Sequence
1812 bases(100 bases per row)
GAGCGATTCGTGATCGCGTGATTCGATTAAATGGGGTTCGGCAATTCGCACCAAATCAAGATTAACATTAGAACCGTACCTTGGAAAGGAACCACAGCTG
TGTGGGATCGACAGGCTCCAACTTTACAACCCACATGTCGTCGTTGTCGTTACTACTATCGCCTTCACTTTTGAAGTCTTTTGTCGCACTTAGTTCGAGC
TTGCCTTCGAGTGCCATCGAAACAGTTGAAGCGGGGGGGGTGTCCCCCACCACTTCCGTGCCCACGAAACCAGGCAAGACAATTGTCGCCTATATTGTGC
CATACAATTTCAATGTTTAGCGTAGGGGGGGTATTGGGAAATCTCCCCCAAATATATGGCTACCGTGTATTTCGCAGCGTTGGCTTCGGGGGACGCCACC
AACAACGCGACGTCTTCTCCTTCTTTGGGCACCAACTTCCATTCTTGGGGGAGGTGGCGAATCGACAACGACAGCAACGACAGGGCCTTGGCGCCTTTGA
AATACTCTGTAAACGCCACATCAAATGCTACCCCCACTTGCACCCCGATGGTGTCGGAGAAAGCCACAAGTTGGTCCAGTTGAACCGCCACGACCAGCGG
CCGCAGCGGCACATCCACCGCTTTCACCAACACGTCTACGTCCTTGTCTCGCGCCACACCTGAAAAAACATCAACAAATAAAGATCGTTTACGACACGTT
TTTGGGAGCTGTGGGGAGTAATAATGTGCGGCCAATCTACCCACCTTGGTACAATGTGACGCGCACCACCGACGCGCACAATTGACGGATCAACGTTGGT
TCGTCCAACGCAAACAGCTTGGACGGTTGTGCGTATCGAAACGACGATACCATGTTCTACAACGCCATACATACATGCCGATTTGAAGATCTCGACACTA
CACTATGGCAGCGACGACCTACCTCGTCTTCACCCGATAGACTCTGTACTGTGAGCACGGCGGTGCTGGCTCGGGCGGCAGTGTCCTGCGCCGATGCCCA
CCATAACGCGGCCGATGCTTCGCCACTAGTCACGACATCCACTGATGCCCAGAACGAAGGGACTACTTGCGCGTTATCGTCGTTATTGTTCGCGTGATTG
GTCCGTCGGACCTCTCCAAGGACAACGGTAAAGCTGCCTTGAGCTGGTGTTCCTGCGACCGGTGAAGTCGGCTGTAGCTCCTCCGCCATCGTCGATTTGG
ATATATGGGGTGCGACCTTTCGAGCTGCCCCGCATCCGGATTGCTAGTGTGTGTACCGGATAACATTTTGATTGCATTTACAGTTATACTACGTAGTAAC
TAGTTAACGTGACGGATCAGTGATTTGCCGATTTTGAGCTCCATTCAATCAACCATATCTGGCGAAGTTCGACGTGAAAGTTGCAGTGCCGAACTCACCT
TTTTGAGCTTTATCTCATCGTCCGAATACAAAACAAGTATGAGTTTGAATCAGGGCAAATAAAATGTCAAAGTTAGGCGTTCAAACAGGCGATCGGTGAT
TTGCCGAAATTTAAACTTGTAGTTATTATTTTTTATTCAGTAAGGGAATTTTACGCCTTCGATGAAACAAAATTATTGATTTATAGAGCAATATTATCTG
TATGCAGTAATAATATTTTACAGGTCATACTTGATTTAAAAACAGCTGAGCCCCTCTTTAAATTAGTACTATTCCCACCATAATATTTTGAAGGTGGCAG
TTATTGTCGATTTGATACAAATTTGGGGAGGGGGTGCAATCGAATCGCGCCGACCAAACCGATCCACAATCGATCTGATTGGTTGAATTTCATTTAGAAG
GTTTTGATTGGC