Description :
From Genome Similarity Track
Location :
Scaffold_937:177- 4245
Sequence
4068 bases(100 bases per row)
GATCGGATGAGTGGGATCACCATCTCATCGGGTAGCTTTACCGCCGAGTTGTACAGATCCAGACGGACTCCAGCTGGGATCATGAAGTCGGTGCCGAGAA
TTAAATCGACTCCGGCATGATGAGGCATTATCCATACTTCAAACTCGTATGCCACTTCCCAGCCGAGTGTCACCTTCACCACTGCTCTTGACGTTGTCAC
CATCCTGTCTTTACTTATTCCTTGTATGTCAATTCGCTTATCTCTGCTGGCCACTCTCTTGAGACGCAGTTTCCTCGCGAAGTACTCACTTATCGCCGAG
ACATTTGCTCCGGTATCCAATAATATCTTGGTCCTTCGGTCGTTCACTGCACCCAATACGAGGGCTCTCATTCTAACTCGACGATCAAACGTCTGTGCTG
ACCACCATCCCAGCCGTTCTCCCGGAAGCAGCTTCATTATCCTAGTACGATGCACAGCTTGGTCTGACTGCCGAGTTACACTTGCAATCGCTCGGTTGTT
ATCATCTAACTCACCGAGCTCACGTTCAATTCTGTCGATTTCACACATCCAATTGCCATCCCCGCTTCTTCCCTCGGGCCGTCCTGCTTCGCCTACGAAG
GCAAACAAGAAGTTCGCCTCAACTGCAGGTTCAGCTGACTGTGGCAGCCCGGCATATTCCAACCCAGTCAGTGTTGGCGGGCCGCCGAGTTTAAATCACT
CGGCGCGTAAAGGTTTTGCAGGTCTTCTGGCACTTGCGACTTGTCGACAGAGTTCTTCACGAACGCAGCCAGCTTCTCATATTGACGAAACAGCTCGCAC
TGGCCGCCTTCATGAACTTGTCTGCAGAATTTGCAGCGTCGTCGACAGTAGTGAGCCGAGTGCCCCATTCTTCCACAAGCTGCACAAGGTCCTCGTTGGG
TGTTGTCGCGTGATCCATCTCCACGGTTCGACTGTTCTTGTTGGTTGTACGGTCGCGGAGGTCGGTTCGCTGAGTTTCCCCAGCTTCGGTTCGAGCCATT
CTGGTCTCCCGCCGAGTTCTCTCGGCGGTCCGGTGTATTTCCCTTATCATTGGAAACGCCGGCGTCTATGTAGTCGTCGTCTTCCGCTGAGTCGTATCCT
CCGGACTGGTCCTCCTCATCCCATTCGTCTTCGGAGTTGTACGGACTCGGCGGGTTCTGATCGAGGAGTTCTTCCCCGTCAGAGTCGGCGTCAACGACAG
TGACTCGGCGATCGCGGTTCTCTTCCGTGCGACTGCGCTTCTCATCTCGACGTCCATCTCGGCGTTCATCGCGACGGCTTTGATTCTTTCGCTTTCCCCT
TTATCGTCTCGCGGCTTGCGGGGAAAAAAGAGAAGCGGGGGCGGTGGTTTTTCTGGGGCTTTTTTCCTGTTGTAATGCGGGAATGAATAATCGCTCCACC
TTACTGATGTCTTCCAACTGCAAGGGGTACATCAAATCCATCACATCGTCATCACCACAATGCAGCAAGAAATGTTCGACATGGTAAGCCGCGTCGGCAC
CACCCTTCTCGTACTGGATATTGGCTGTCCGAGCATACCCGTTGAGTCGGATCAGGAAGTCGCAGATCGGTTCGTTGACTTTACGTCTCGCCGAGTAGTA
ACGAGTGCGGGCGGATTGGTCGAACTGTGAGCAATAATAATCCAGGAACGCCTCGCTGAGTAGTTTCCAACGTCGCTGAGTCTTCTTCGGCAGCTGCCTA
TACCAACTCTTTGCCGCGCGTCCCAAGCATAGCGAGAAAGGTTCGCACCAGGCACTTTGGGGCATCCTGGTGCTCTTCATCTCGTAGATGAAACGCTTGA
GCCACTGGATCGACGCGTCGGAACGGTAGCGCTTTCCTTCGAACTCGGCTATTTTATCGAGTGAGGCGTGGGTTCGGACTTCTAGGTACTGCGTCGAGTC
TTCTTCAGCCGCGTCAAAGCTCAAGTTTCGGATGTAGTCCTTCACGGTTTCTTCACGGTTTCCTCTCACGTCGAAGGCGTCGTCGTCTTCTTCATCCTCC
TCGTAAGCCTCAGCCTCGTCTGCAGCGTCATACAATTCACGGTAACGACCAACATTTTGCTGTCCACGACTCGGCGCTCGCTGAGTCGGGTTTAGCTTCA
TTGGAATCAGCATGTGGGAGTCTTCGAAGTACGGAGTCCCTTGCGTAGCGCGGAACACTTCACGTCTCTTCGTCTCCAGGGTCTTCGGCAAAGGAATTTT
GCTTGGGTCTTCGCCGAGTGGTTTGAACTCGGCTACTCGGCTGTACACCTTCTTCGTTCCATTAGGGGCCTTCTCCAATCCAAACGCCACTCTCAACTTC
TTCTTCCATTGCCAGAGCTCAGCTCCGCCACGGGTCAAACTCCAGTCGGACAGGATGAGGCTGTTTGGTAGGCTGTTGCACCGATAGCCCATCGCCTTCA
ACAGCAACACAGTTTCTTCCACCAACTGATTGATGTTGGCTGCACGCACCGGTTGAGTTAACTCGGGACCCAACATCGGCCACTTCGCCTGCGCCATCGC
CACAGGCGCGAACATCATCATCCATTCCGATCTCGTTCTCATCTCCTCGCCGAGTCGAGCCAACACTTTATTGGCGCTCGGCGTATCGGCGTTCCTCGTC
GCTTTCGGAATAAGGGGCGGACGGTCCCCTTGAGCAACGCCATGTTCTTCTTCATCTTCTTCATCGTCTGCACCTTCGTCGAGCTCGTCGGATAAGTTGT
GCTCGACAGGACGTGGGGCTCCCATGCGTCCCACCTGCAGCGTCAACTCTTTCACCTCGCCAAGTAGCTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGC
GGTCTCGGCCTTCTCTTCATACTCTCCTTCACTTGCATCTCCGTTCTCGCTCTCCTGGTCTTGGCCATCCTCGTCGAACTGGACGGTTCGTCCCACCTCC
ATCGTCATGGCGATGAGTCGTTGATGCGCCGGGTCCGACCCCGCGAGAGGCGATCCTCCAACCGTCGCTGGGCTTCCGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN