Description :
From Genome Similarity Track
Location :
Scaffold_238:177- 2004
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_238-fgenesh-gene-0.0Prolyl-tRNA synthetase

Sequence
1827 bases(100 bases per row)
GCTCCGCTGCCGGTGGCGCGTTCACGCGGCGGTCGGTGGTGTGGGCGCCGACGGAGAAGCAGGCGCCGGCGGACGCGGCCGTGCCGAGCCACCAGCTGCT
GCTGCGCGGCGGGTTCGTGCGCAAGAGCGGTCACGGCGTGTACGCGCTGCTTCCGCTGGGCAAGCGCGTGGCTGCCAAGCTCGAGGCGATCATCGACGAC
GAGATGCGGCGCATCGACGGCAACAAGCTGGATCTTCCCGTGCTCATTCCGGCCGAGCTCTGGCAGCAGTCGGGCCGCTGGCAGACGCGCGGCCCAGAGC
TCATGACGCTCGCCGACCGCCGCGAAGACACGTACGCGCTCGGACCGACGCACGAGGAGAGCATCACGAGCCTCGTGGCGGCGCACTACGCCGCGGCGCC
TGGCCAGTCGCTGCGCGTGTACCAAATCGGCCGCAAGTTCCGCGACGAGATCCGTCCGCGCTTCGGACTGCTGCGAGCGAGAGAGTTCGTCATGAAGGAC
ATGTACTCGTTCGACATGAGCTTCGACCGCGCGCTCCAGACGTACGAGGACGTGGTCGGCGCCTACGAGCGCATCCTGCGCACGCGGCTCAAACTGCCGA
TCGCAAGGGTAGAGGCCGACTCGGGCAACATCGGCGGCAACCTCTCGCACGAGTTCCACGTGCTCGCACCGATCGGAGAGGACGCGCTGCTCTCGTGCTC
GTCGGACGAATGTGGCTACGCGGCCAACGTCGAGAAGGCTCAGGGTGTTCTGTCGCCGCTGACCGGATCTAGTCAAGCGAATGTCTCCCTTGACGACAAA
GAGATCGCTGACCTGCTTGCTCAAGTCGAGAAGCAGATCTCGGAGCGAGATGTCGGCGTCTGGAAGACGATTGAGCAGCTGCAAGAGTCCGCTGGATCAG
CGGGCGTGACGCTCAAGGTGCTGCACAAGCCACAGGACGATGTCGAGGCTGGCGAGACGACAGGACCGCTGCAAGTTGCACTCGTGTTCGCTCGGAGCGA
CCGCGAGGTGAATGAGCTCGCCATCAAGCCGTTCTTCGATGGCGACGAGCTGGTGCCGCTGTCGAGGTCGCATTTCCGAGATCTGGACGTGTCGGACGCG
ACTGCTGTGCATCTGTCCGTGTTCCTCGACGACTCTCTCAAGGACGACGCGACTCCAATTGCTAGCACTGTCCGAGTTGCCGCCTCTACGACTTCTCTTC
TGGTTGAATGGGGCCACTTTCGCCTGGCCGCAGAAGGCGACGTGTGTCCCCGTTGCTCAGGACACGCCAAGCTGGAGGCCAAGCGAGGCATCGAGGTCGG
CCACGTCTTCTACCTCGGCCAAAAGTACTCCAAACCGTTCAACGCAACGTTCACCGACTCGCACGGCGCCAAGCAGTTGATGGAGATGGGGTGTTTCGGC
ATGGGTGTCACTCGGCTCATGGCCGCGGCCGTCGAAGTCTCGCACGACCAGCACGGCATCGTCTGGCCCACGGCCATCGCGCCGTTCAAGGTGCTCGTCA
TGACGATCGGCAACAAGAAGGGCGACGACCCGATCGCGATGACAGCCCAGTCGATCGCCAACGACCTCGGTTCGTCGGGTGTTCCTGGACTTGCTGGGGA
CGAGGTCGTGCTCGACGACCGCTGGAGCGAGAGCCCCGGCTCCAAGCTCGCCGAGTCGGAGCTGCTTGGCTACCCGTTCCGAGTTGTCGTGGGCAAGCGC
TTCGCCAAGGAAGGACTGGTCGAGGTGCAGACGCGCGCGACGCTCGAGAAGACTTTCGTGCCTCCCGAAGAGCTCGTGCCGCTCTTCCGCTCGCTCGCCG
AGGCTGGGGAGCTTTAGACTTTGGTGG