Description :
From Genome Similarity Track
Location :
Scaffold_2373:177- 1501
Sequence
1324 bases(100 bases per row)
AGCGTGTAGAATGTGTGTCAACACCCGCAGCAGCGCGGGCACTTCCTTTTCCGATTCGTGATATCGTACCTCCGCGTCGCGCAACGTCCTTCCCGTAAAC
CGGACTGGACACCGTTTGCCGTCGTGTTCTTGTGTGAGTACCGCGCTGACCGCCCACGAGTTATCGTGGAGGATAATTTGCAAACGGTTTCTGACGATCC
GGATGCCGGAGGACTGGTAGCGATTGGATCTTCTGCTTAAGCAACTCGAAAGCCTGCTTCACCCGCTCTAGATCCCAACCTGCACGGATTTGCTCGTCCG
TCAACTCGTACAGCACTAATGCGATCACCGAGTAGTCTTTAATGAACTTGTGGTAGTAGTTGAGGCTTCCGAGAAAAGACTGTACGCCTTTTAAGTTCGA
CAGGAACTGCAGCTTGTCGATACCTTTGGCCACCTTGGCCAGCGCGCGAAGACCAGACCGGCTGACTTCATGAGACAGGAACTGGACCGCCCGCTTGCCG
AACGAACTTTTCGGCAGACTAACGCTGAGGCCCCAGTACCTGATCCAGTACAAGAGCCGGTCGGCGATGTCGCAGAGCTCGTCCCACGCGCACGTGCCGG
CCGCAATGTCGTCGATATACGAACTCTTGCCGAGGATCGGACCCATACAGGCCGGAGCCGGGAGATTTCGCTGAAACACGGTTAGCTCGTCTTCTTGTCC
GTCACTTGGTTGGTAGCTCCCGCTTCCTACGTCGCCGGAGTCGGCCATGGCGTCTCGAACCAAGGCCTCATCTCGCTTCACTCCCACCCCTTCGAGAACG
TCGGGGTCGACTTCGGACTCTAAAGCCGGAGGTAGGCGGACGAAGCCCCACAAGCAGTTATCAATAACCTGCTGCTAGATGAGCGGGGCGTGCTTGAGCC
CGAAGGGCATCCAAACCCACTGGAAGTGACCAAGCGGGCAGATGAACGCACTAATGTGTCTGGCCCTCGGGGTCATGGGCACAGCCCAGAAGCCACTGGC
CATGTCAACGCTTAAGAACTACATTACCGCTTCGAAGTCGTCGAGCAACTGGTTGTTAGGCGGCAGCGGGTAGCGCATGAGCTGGATGAGCTGGTTGACG
AAGCGATAGTCGATGCAAAGCCGGATATCTTCCCCGTTCTTCTTCATGACGATCACGATCGGACTTGCCCAGTCGAAGTAGGAATACTCGATAATGGGGC
AATCCAGCAGGTCTTTCAGCAACAGGTATATCTTGGGCAAAAGATGCGCTTTTATCGGACGCGGTCGCTGGGCAATGGGTTTGGTACCTGCCGGACTTCG
ATGTCGCAGACCACNNNNNNNNNN