Description :
From Genome Similarity Track
Location :
Scaffold_5305:177- 1404
Sequence
1227 bases(100 bases per row)
TGTGTTTGAAGTCGGTCGGATCGCCTCGAAGAGTATGAACCCTGTTCTGCGTCGGAGCTCCTACATCGACGACATTTCTTACGGCGCCCCGAGTTGGAGC
GAACTCTGCGAAACCTTGAACAACCTACTGTACCGTCTGAGATACTGGAGAATCTCCGTGAGTCTCCCTAAGAGCGTCTTTGGGACCAAGTCGATCGAGT
ATCTGTCACATCAAGTGATCCGCGAAGGTATCGTCGCGAAATCGAAGCTTCTGAAAGGACTCAAGGATCTGAAGTTCCCGTCAAGTCTCAAGGGTGTTCA
GTCTTTCCTCGGCAGTCTGAACTACTACAACAAGTTCGTCGAGCACTTCTCAGTGATCGCGTCGGTGTTGTACGAACTCTCGGATGACCAGGTGCGAAAA
GGCATCGACCTGGAGCGTGCTCGGTCTGCCTTTGACATCCTGAAGGACAAGATCACCCAAGCACCACTCCTGAGACACCCTGATCGATCTCGGCCCTTCT
CGATCATCGTCTATGCGAACCCTTGGGCTGTGAGCGCCGTGCTCGGCCAAGAATATGATGGAGTCATCCACCCGGTGCGATTCACAGGGCGAATCCTACA
TGACGGCGAGTTGCGGTACCATGCCTCCGAGAAAGAAGTGCTCGCCCTCCTCCGGGTGTTGAATTCCTTCTACACGCTGGTTGTTGGGCAACGCGTTCAA
GTCTACACCAGGTACTCTGTCCTGAGATGGCTGATGAAGTCAAAGACCCTTCAGGGGCGATGCCTGCAGTGGGCCACTATGTTGTCTCCCTGGGACCTCG
AGGTCATCCAGGTTGAGAAGGACGAAGATGGCCTTGCCGCAATCCTCGCTGCAGGAATCACACCTCGAGAGAGAGTGGACGAAGTAGTGTCCGAGCTTAT
TCCAAGAAAAGGCCTTCGAGTCAAGACGCCTCCGATCAGCCTCGAGATGTTGTCTGAGAACTATTCTGGACACCTCATGAGCTTTGACGGAGCCGCCAAG
CTCAAGACCCGAGAAGGAAGTGCCGGCTTCATCGTCTGGAAGCTACCTGAGTGGAAGATCGTGGCTGCCCATGGGGCGCACCTCAAGGATGTGACGGTAA
ACGAAGCAGAATACCAGGGAATGCTCCAGGGTTTGAGTCTGGCCTCCAGCCTGAACATCAAGGAATTGGTGGTTGTCGGAGACTCCAGGATTGTCATCCA
GCAGGCACAAGGATTGATAGGCTGCAA