Description :
From Genome Similarity Track
Location :
Scaffold_1730:177- 1271
Transcript NameFunction/comments
Phyag_g11361hypothetical protein PHYSODRAFT_260223

Sequence
1094 bases(100 bases per row)
tgtattgaggagcgcgagacagcgactcctATATTGTCTTACCGTTCGGGGCTTGACTCCGGCACCCTCGTCTCGGGCTGAAAAGTCTCTGgacccttcc
ttctgagggccGACGAGGTTTGAAGAAtagtgaagaagcgtgctgactctgctcgtagtcagtGGCGCTTGGATTATTTGGTTGGCCTAccgacaactca
cagcaacacagggtcaagatcagcccggtgtaagggatcggatctgggtcttcagattctattcccacttctcgttaAGTCTTTGCGGgcgagacgagtg
ttgtgggtgaaggagtgtgacagaagcaaaaaactgccgtgttccgacacgacatATGCGTCAACCACTCTAAATTCGTGTTTACCACACCAAAAATGAC
GCGTTACGCAGCAACGTCTCCCCAAGCCCAATTCTGCGCAAAGAGGACCGATTTGCGACGCTCGCGGACGCCGTGGCGGTGGTCGAAACCTTCGCGGAGC
AGACGCNTGAAGATGCACAAGTGTTCGCGACGAAGAGTGGAGGCGAACGCTCCCTGTCCCGCAACCTAGCGGAAGAGTTTGACGATGAGTCTGACCCCGA
GCCAGCTCAAGTCGGCTATGATGATGTGACCGAGGATTCGAAAGCCTCGGCCAGGGTGGGCATGAGCACCACCCAGCAGGAGGGTGACCGCCCTCCAATT
AACGGTGACACCCCTGTGGCGAACAAGGTCCTCGGACGGTGTTATCACATGATGATGGAGGAGAGCGAGTGGATGCGCCTGTTCTCCCCGAAACCAGTTC
GACAGGCGCATTGGGTGAACCTGAAGCAGGAACTCAGCTACCCGGTCAACTCGACGAGTACTAGTCAAGTCGCTGAAGACACGGTGTCGCTTCTAGCTGC
TATGGGGTTCAAGGTGAAAACGTATCCGTCGTCAACTGCGCTTGCCGACTGGACTCCAACGAAGGCTGGCAAGGAACTCcagaagtggaagaagagactG
CGTTCAGCCTTCGGAAGCAAAGGTCTCAGCTCTGGACGACAACCGGTGGCGAGAAGTGGCGGTGACATGGTGGATCCGGCTGCTGTTCCGCTGC