Description :
From Genome Similarity Track
Location :
contig_49:176991- 179915
Transcript NameFunction/comments
g9701.t1POM66521.1 Phosphatidate cytidylyltransferase [Phytophthora palmivora var. palmivora
g9702.t1POM71809.1 Alpha-N-acetylglucosaminidase (NAGLU) [Phytophthora palmivora var. palmivora

Sequence
2924 bases(100 bases per row)
GACCGTCGTGAAGCAGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCTTCAGGTTGTACGTA
CGCTTGATTGCCGAAGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATAGAGTGAAACTGCATTCACGAACACAACCAGA
CAGCTCGTCAGCAATCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAATTAGACCCGCCAGG
TAGACCGGTACGCCGTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGTGGGTCGGGAATCAGCTTGAACTGTAGCAAAATAAAGACATCAG
TGTTACCATAAGCACGTATGCTGCATGAAGACCAGTGCTTTGCAGCATTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGCAGGTCAACCAAGAA
AACTAAAACGAACAAAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGCACTGGAAAAAAAGG
CATAAATCACGGTGCAAACGAAAGCACCAATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAAGAACGGCGTCTTAATGAACTTGCGACCAAAAAG
CTTGCCGCAGAAGAACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACAAGCATATGAATCCC
GTTAGCAACTTGTGACAAGGTCAGGATATTTATTACATTCGTACCGTTGAAGATATTCGTGAGGACGTATTTCATCTGGAAGACGATCAAACCCAGCGTG
ACAATGGTCCACGTGTATTGCCCTGCAAGCGAGAAATTCACAAGTTAGAATGTCTGCAAACTCAAAACGAGATTCCTGCCAACTTACCCATCTGGTACTT
GTAGTAACCTACCCAGTCAATAAAACCACATCGTTGACACCAAAATGTTCGTCGGCACAGCGTCAGTCGTTGAAGCAACCGTACGACAGCACAACGAGCT
CAACATCAAATCTACAGTCACGCACCTTTCTTGAGACTCAGCACCGACATGACGAAGAGCATAGCGTACATGGTGAACGACACCCACGTGTGGTACCGCA
GGTAGTGCACGATGGCAGGCGGCACGAAGCGAATCTTGCTGCTCTCGATGAAGGCGCCGAACGAGTCGCCGTAGTTGTAGAACAGCGCCACCACGAACCA
CATCCACTGCAACCACAAGAGTCAGCATTAGTCTATACCTTCCCTCCTCCTCCCCCTCTCCATTTGCAGCTGCACGCACCTGCACGGAGCGGAACCACGG
GATATTCTTTTCGGCCGCCGCCCGGTAGCGCACGTTCACGAGCTCGCGGAAGAGCAGCGTCTGCAGCAGTACCACGAGCCCCCACGCGTACATGTGGCCG
CCGTACAGGATGGCGATGAAGCCGCCGATCATGGCGAAGCCCACAACGACGCGCGTCATGAACTTGGTCAGTCTTCCTGCGGGCTTGACCGCGGGTGGCG
ACGCATTCTGCGCGTGCTTGGGGCTCCCCTCAGGACTCGAGCGGCGTTTACGCAAGGCCATCGTCTGCTGTGTCTTCTGCTTGCCTACTTGTGCTCTGCG
CGCTCGGACAGCGTTTATGCCTTGTCTGCGTGGGGGAAGTGTACGTCAGCGAGGACAGCACCCTTGTTTGAGGCTAAATGAGCTGCCCAATTCTTTCGTT
AAAACCCTCAATGAGTCGGCCATTACGACCAATAAGCGTTCAGATGTTATCTTATTGGTTGATAAAGGTGATTATTTGAGTGCGTACGACGCAGAATATG
GTGTTTTTCAATTAATCGAGGACATTACCTCGCGCTGCTTCGTTACGTCATGACACGCAGCGATTTACTTCAGTTTTATTAATTGTCGTTTAATTACGCA
ACTAATTACGTGGTTGAAGAGCTCAAAACTCAGATTCGATGAAGCGAATCTTGGTGACGCTCCTGCTGCTGCCGCTGCTCGCGGCGGCCTCCATCGACCA
GCTGAAGAAGAGCGCGGGGGCGCACGACGTCGTGGCGACGACGCGCGGGCTCATCCACCGCCGACTGGGTGCACGCTTCAACGACCAGGTTCTGCTGTCT
ACGATCACTTACACGTAGGAGATCGCAATGGGAAACTAACAATGCATTGATACTAGATAACGCTCCGAGTGCTGCCTTCCGAGGCCGATAATCTGGACGT
GTTTGAGCTGGGTAACGACGGCGACAAACTCGAGATCGCCGCCAACTCGGCCACCGCCATGGCGTACGGCCTGCAATGGTACTTGAAGACGGCACTGCAC
ACGCAGACAGACTGGGACGACCACAAGCTGCAGCTGCCCTACGTGCTACCAAAGGTGGACCAGCGCGTGCGGCACAAACGTAGCAGCAAGTTCTCTACTA
CCAGAACGTGTGCACGGTGAGCTACTCCTCGTGGACGTGGGGGTGGAAGAAGTGGGAGAACCATATTGACTGGATGGCGCTCAACGGTGCGTATCTTTTA
TATATATTTCAGATGCAAGATGAGACTTAGGGCTTAGTACTGACACTCGTGTGTCCACTGCTGCTCAGGTATCAATATGCCGCTTGCGTTCACTGGGCAA
GAGAGGTGTGGCAGAACACGTTCCAGAAACACTATAACGTTAGCGCTGCTGGTTTGAACAAGTTCTTCGCCGGATCAGCGTTTCTGGCGTGGGGTCGCAT
GGGCAACCTCCGTGGCAGTTGGGTGGAGGGCCCACTTCCGCAAGCCTTTATTGATGGCCAGTTCAAGTTGCAGTTGAAGATCCTGACGCGCATGAGGGAA
TTCGGTATGATTCCTGCCTTGCCA