Description :
From Genome Similarity Track
Location :
Scaffold_82:176958- 178376
Sequence
1418 bases(100 bases per row)
GAGGCTCGGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCACTGCGGAAACAAGTGTAATTCTTTATGGATACCAAGCTGAGCGTTGTC
AGCAGGGTCCGCGATGCCATGGCAGTGGCTCAGGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGCTT
AGTGCTACTAGACACGAGGAGCCTACCTCTTGACACTGTCATCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCC
AGACATGGTGCGTCGTACACCATCGACCTGCCTAAGTCAATGACGACGCACCCGACGCTCTATGCTGGACGTCGTAAGTTGTACTTTGATACGCAGGGGG
TTGCTGACTCGCAGACCCACCCACCTTGACACAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGT
CGGAACGGCAAGGCTGCGGTCAAGATCGTACGCCGGAGGGGCTCCGTACGAACGGGTTCCGGAGCCATACGCCGAGTACGCTGAGCTCGCCGGGTACGCA
CCATACGCGTACGTCTGGTAGTGTGCCGAAGGCGGCTCCGGACGTACCAACAGAGCCTCGATCCGTCGGAGCATGCGAGGGGCCTCGTCCAGATCGGACG
AAGAGGCCCGGCGATCCACCCGCAGATGCAGGATCGCGACCTCTCGCTCCAACAGGTCCAGGTGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGC
CTGGGCGGCAGCATCACCACCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGATGACACGTTAACGGAGGCGGTCAACCTCAGAGCCCTGTGTCGGATCC
GCAGCCGGAGCACTCCGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTC
CACTTCCACGTGGAGCGGATCCTCCAGGAGCTACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCAAGAACTTGTGGG
AGCCGATTGAACGGCTTCTGATTGACTGCCAGAAGGCTGTCGGAATCCGGAAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCTGGGCTTCTTGTCCGAA
CGGGGTACTGACGTTGAATACACTCCGTACCCGCGCTCATCGTGAGCGCTGGAAGCCGCACGCTTTAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCG
AGTGGGCAAACCGAACACGAAGATCACGCTGGGCCAAGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTTCTTAAGAGA
CTCCACCCATGCCCAGAA