Description :
From Genome Similarity Track
Location :
Scaffold_120:17695- 23454
Sequence
5759 bases(100 bases per row)
TACTTCTTAAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGCGACGTAGGAATGTCTAGCGTGTAGGCATCACCCATAACTCGTAGTACTTTGAATG
GCCCAATGTAGCGCGGCGCGAGTTTGCTCGCGCCTAGGTTCGTAATAGCAGAGGTACGAATTCCATCCGTTGAGAGTAATACCCGCTCACCAATCTTGAA
TACACTTGTGTTCTTGCGGCCACGTTTGTCAGCGTTTTCCTTCTGCTTGTCAACCGCGAGTTGTAGCGCGTCACGGACGAATCGGGTAACCGATTGGCGA
TGAAGGACAAAGTCGGATACCGCTGCCTTGTCAGCGGGTCGCGCTGGGGGTTTCGGCGCGTAATTAGCCACAGTCGAGTGTGGCTGTGCTGGAGCGATCA
GCGTTCGGTGTGTCCAGTCAACTAACGGCGACGACGTGGATTGCGCGGGTGCGAGGATCTTCTTCGACTGTAAACGCGTCACCGCGTTGATGTCTACTGC
AGGAGTAGCTGACTCGTAGACGGCAGAACCGTTGTCTCACCGGAAACCGGTGGTTGAACCAGTATCGGAACCGGTTGGGCAGGGTTATCACATTCCTCCC
CCTCCAGAGTGAAGCCATCAGTCGCCGTGGGTTGGCCCACAGCAAGTTGTGCGGGGACACGTGGATGACGCGCGTTGTTGACGAAAAACGGAGTCAATCC
CGTCGACGCGTGCTCGGCATTGTTGAGTGCAAACTCCGCAAGAGGCAGGAAGGAACTCCAGTTCTCGAAGGAAGGGGCATAACTGCGCAGAACATCTTCT
AGCACGCGGTTGACGCGTTCCGTTTGCCCGTCAGTCTCCGGGTGCACCGCCGTCGACATGAGGAGTTTGGTGCCCAGGAGGTCGAAGAGTTTTGCCCAGA
ACGCCGATGGGAATCGGGGATCGCGGTCAGAGACGATTGATTCAGGAAGGCCGTGATGTCGGAAGACAGCGTCGACGAAGAGCACCGCGGTATCGGCCGC
GGTGATTGAGTCCGAAACCGGAACGAGATGGCACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGACCGTCAGTATCGGGTGGGAGACCG
AATATGAAGTCCATTGACACAGAGCGCCACGCCTCTGTCGCCAGAGGGAGAGAACGCAGCGGAGCTTGCGATGAAGGTGACAAACTTAACGCGATGACAA
GTTTCCCAGGAGCAAACCCACTTGCGCACCCACTTGTATAGGGGAGGCCAGTAGAAGTCGCGGGATACCGCTGCGAAAGTTTTCTCACGGCCCAAGTGGC
CACCCACTGGAGCGTCATGGTATTCTTGTGTATAATTCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGCATCGAATCGATCGATACTG
TACATCAGTAGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCATGGAGCGGCTCAGTGTCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGCT
CCAGGATACCGGCATATATCGAGTCATCTCGATACGCGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATACCGCCGTCATCAGGTTCACACCTGC
AGCCACACATGTGGCGCAGTCCAATTCGTCGTCGTCCGCGTCTTCAAGTGACTGACGACCCAAATCTCGGCGTGGATCGTAATCGGGGCGCCGAGATAGG
GCATCCGCAAGGATGTTATTCTTGCCTGGCTTGTAGTGGACGACGAAGTTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAGATGAG
GGCTCTTCGTCGCTGTTCGCAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAATTTGATCAGTGCGTAGCGCAT
CGCAAGGTGTTCCTTGTCGTGAACCGGATAATTCTTCTCAGCGGGCTTCATCTGTCTGGATTGGTAGCTCACGACGCGTTCGCGACCTTCGTCGTCGAAC
TGCATCAGTGCACAGCCGATGGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGCATCATCTGGAAGCGTCAGGATTGGGGCCCCCGCCAAGC
TTTTCTTCACTGCATTAAAGGCCGACTGATGTTCGGGAGTCCACGACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGACTGGATCAGACCAGCATA
AATTTTCGTGTACTTGTGGAGATAAGTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAAATGGACGAGACCTTC
TCAGGATCCGCTCGGACACCAATCTTGTCACATAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAGTTCGCGTACAGTTTGTT
TTCGCACATGACTTGGAACACTTGTCGTAAGTGATTTAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAGCGAAGATGTCATCGAAG
TAGCTCGGAGCGAAGTCGCGAAGTGGGCGCAGAACGTGGGAAACCATGCGATTGAACGTGGCTGGTGCGTTTTTCAGGCCCTGCGGCATGACAAGCCACT
CCCACAGCATCCTGCTGGGAGTGCTCACCGCTGTGAGCGGGACGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATGGTGCTGAA
AATAACACTGCGGCCCATGGTGTCAAGTACCATATCTTTCCGAGGGATCGGCGTTTGTGCTGGAATGGTGGCGTCGTTTAGCTTGTTAAAAGCGTGAACA
ATGCGCCAAACACCCGGGGTTTTCTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCGCGCACGTGACCCGCTTTGCGGCGGCTCTCGAAGA
AGTCGTCAATGGCTTTAACCTGATCGCGTGGGAGGGGCCACTGTCGCGTCACACAGTACTTGGAACCCGGCGTGAGATCAATCTCATGGCGAATGCCTCT
GTCAGCAGGGAGCTCAGCTGGAATCTTGTCGGGAAAAACATTCTGCGAGCTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCA
CGACTGGGCAGCGAAGCGCTCTTCGCGCGCCGACTTCGGCTCAGCGTTCTTTGGACGAAGTGGAAGATTGTCGGTAGCGACCGTGTGGATCTCTTCCGCC
GAGGCAGACTCGGTGATCAAGCAGACCTGCTCGATGTCTCCTGACTTCAGATCGCGCAGAAAATGCTTCCAGGAAAGACCCGGAAGGCGTGTGATGGAAG
AAGCTTCGCAAGGTGGGTTCTCAATGTCAAGTGTGCGTGAGCGAACGACGCCTCCTTCTACGTGTTCCAGGACGTGTATGGACTCATTCACTGCGATATC
GGCGGTGGGCTGACCACGTCGCCTAAGGCGGCGTCGCTTGGATTTCTTCTTGCGGCGTCTCGAACCGCTGCTCGAGGCAGAAGACTCGCTATCGCTGGAC
GAGGGAACACCCCCCTCTAGACACGGAGGGGCACCATCAACCGTGTCGGTAGTGCGCGGGAGCTCTCGGTGCTCGACCGCGCCATCGACAGGCGAGAGCC
CCTGCTCGATCGCCGTCGTAGCCGGTGGGAGCGTCAACTGCTCGACCACCGCTGTGGATGACGGGAGCTCCAACTGCTCGACCGCCGAATCGCGTTGCGG
GAACCTCTGCTCAGCCGCTAGAGTGTTTTGCAGGAACCCATGCTCAACCGCCTTGTTGTGTTGCGGGAATCCATGCTCGACCGCCGTGTTGCGTGACGGG
AACCCATGCTCGACCGCCGTGTTGCGTGACGGGAACTCATGCTCGACCGCCGTGTTGCGTGACGGGAACCCATGCTCGACCGTCGTGTTGCGTGACGGGA
ACTCATGCTCGACCGCCGTGTTGCGTGACGGGAACGCATGCTCGACCGCCTGCTCGGATTGCGGGAGCCCCTGCTCTACCGCCAAAGTGTTAACAACCTC
GCTTCGCAGCGAGGGGTTTTCGCGCAACAGCGCTGTGCAAGACATACAGAGAGGGCCATCGCTCGCTCTCTGCTCAACCTGCATTGTGGACAACCGGTCC
ACGACCCTGACATGGGGCCAGTCCTTCTGGGCAACCAGGAGGTGTGTGAACACCTCACTCACATCGAAGCCAGAGCGGTATTAAACCGACCGAGCCAACC
AGCCAATATCTGGTTGATATCGTGACAGCCACGGGATACCCAAGATGCAGTCGAACGCGTAGTTCATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAA
GCCGTCGAATGTGTACGGCAACGTGATCTCGCGCCGCGCAACGCGGCGTGGCTTTCCGTCAGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACT
GCGATCTCTCTTGGAAGCATCGATAAGCACGATTTACGAAAGAAGTTATTCGACGCTCCTGAGTCCAGGAGTGCGCGAAGTGGTCGCCGGGCGCCGGCGA
CATGAAGACTGACGATGATCAGCCTCGAGTCGCCCGACGTGGTGGTGGCATTAAAGTGTGCGTGGAGAACAGGAGAGCTAGAAGGCTGGATCGCCACCGG
GGGACCCGGACCTCCATTCCAGCCAGTAGGGCGCCCGCACCTAACTAACCCTGGCCGGTTTTTGACTGAACGGCAGGTGAGACTTCGGCGGTGTGCGCGA
GTACCGGCGCTGGCACGCGGCATTCCGCCGCGCGATGACCGATCTTCCGGCAGCGGAAGCAAGTGAGCGGGCGATAAGGACGCCCGTTAGGCCCACGAGA
AGTCGACAGACGGTGACTATTCGACGCGTCAATCGCGTCGAATTCCATGGGCTCGGGGGCTGACTCACGAGCAGCCGTAGACATCGCGCGCGCGTAAGAC
GCCGCCACAACATGGTCTTCGCGTAATGCGAGGGCGAATGCTTCCTCGAGAGAGGAAGGTTCCGCTCGGGTCAGGCAGTACCGTGTCATGCCTTCACGCA
TGCCGAATACGAATACATGGACCTGCGATGCTGTGTCAATCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGCGCATTGA
CATTTTACCTTGACGAAGGGCGAAGAACTCGGCACGCACGCGGGACTCGTCTTGAGGGGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGACTCCAGA
GTGGGGAATGCGTCGTGATCAACGACAAGTTTACCGAGGGCCCATTCCTTGGCCTTCCCGGACAACCGGGACAATAAGAAATTGACCTTAGACCCTTGCG
CTTCGATCATTCTCGAAGCAATCGCGATGTCGATTTCGCGAAACCACCGGTTCAGCGGGAGGTGATTCGCTCCTTCACCAAAGTAGGTAGACGTCTCTAG
CTTCACGACGTCATTTTGCGAGGAACGCGCGGGAGTTGTTGCTCGCCGATTCGCATGGGCTAGCTCGCGCTTCATGAACTCTTGGGCTGCTTGGCGTTGT
TGGTCAGACGTCGCTGAGCTCAGCAGCGACACGATTACAGCCTCACCAGACACCGCCGCGAGGCGGTGGAGGGCTTCCCACTCGACACGAGTGAGATGAG
GGAAAGCAGCATGTTCCAGGGTCGGCCCTAACGTTTCAGATGTCATGCCTTGACTCATCGTGAACTTGGTCATGGGAAGGACTACAAAGTGCTACCAGGT
GTAACGGGCCTGGGGTGTCCGTTACTTGCTTACACGTAGTAATGAGGAAGCGTGCAAGT