Description :
From Genome Similarity Track
Location :
Scaffold_293:17693- 19024
Sequence
1331 bases(100 bases per row)
CTGGCTCGCTGTCTTTATCTGCAGTGCTCTTGGAGTGTACTGCAGCAAGATCACTTGTTGCCTCTGGGAGTGTGTCTTTGGACGCACTGGGCGTGATGCT
GATTCGATCAGTAGCGTGGTGAGTACGATCATCCTCGCTATTACTTTCCTCTTCTTCACCGAAGTCGACGTGATCGGCATTGGCTCTAAACGTGGTGACC
GCATCGTCATCACGTGACGAGTGAGAGGCCGGATTGATGGTCGCTCGAATGAGTCCCTCCCCCCTTAAACGAGAGTTACACTCTAAAAAGGTGGGAAGAC
GCGGATGGTGTAAGCCATTTACGAAGAACGGCGTGTGCATCGTTGACACATGGACTGAATCGTTGATGGCGAACTCCATTATCGGCAAGAATTCGCTCCA
ATTCGTTAAAGAATTGACGCACCCTCGAAGTATCCCCTTGAGGACACGATTGGCGCATTCTGTCTGACCATCTGTTTTAGGATAACCAGACGTGGACATC
TTTAAGCGCTTTCCGAGTGTTTTGAACACGGAACGAAAAAACTCTAATGTGAACCTCAGATCCTGATAGTACACGAGTTCACGAGGCAACCCATGAAGGC
GAAATACCGTGTCGATGAAGACACGAGCACAAGGCGATGCGTTGACTTATTGGGTACAGCAACCAGATGTACCATATTGCTGATACTGTCAACGAACACA
AGAATATTAGTATTGTTGTGAGAGTCAGCGGGAAATCCGAAGAAAAATTCCATTGAGATAGATTCCCAGCACTGTGCCGGGACGGGCAGAGGCTGTAACG
GGGCTCAAAGGAAGGGAATAGACTTCACCCGTTGACAGACCTCGAGGGCCTCAGCGTACTTGCGTACGAACTGATACTGGCGGGGCCAGTAATAGGCACG
GCTTACTGTGAGATATATTTTCTAACGACCACGATGTCCACCAACAGGTGCGTCGTGGTAATCATACATAATACGCAATCGCAGATCACCATTAGGCTCT
AGATTAGACATGTCTACAGAGGATCGTCCGCAGACCGACGGTCAGACTGAGTGCGGTTATCGCGTCGTCCGTGGTGTTCTTCTCATTGATTGTACTAATT
CGCTGAAGAGTTGGAGCTTGATGCTCTCTATCGTTGAATTTGCGATAAAAGACGTCGTTCGTGCCTCTACAAGCTACTACCTTGCTAAATAAATAGCATC
ACACCCGTGCATCAAGCTAACGCTACCACTGCGTTGTGTTGGGCTTGATGAGGGATAGTTTGCCGATACACTTGCTGATATCAACCAAACCACATGCAGC
AACAGATAGGCAAGTTTCTCGCAACAGGTAT