Description :
From Genome Similarity Track
Location :
Scaffold_28:17692- 21914
Transcript NameFunction/comments
Phyta_totarag1488hypothetical protein PHYSODRAFT_327149
Phyta_totarag1489hypothetical protein PHYSODRAFT_480634

Sequence
4222 bases(100 bases per row)
CGTCATTTATGTAAAGTTGGACAGGAATTTTGGTAAACTAATCACTCAATTGAAATCTATTTTTGGACATTTTGGGGTTTGGAGGCAAAATTCCGGTAAA
CTAACCACTCAAAGTGCAATTTAGTTTTGGAGATTTTGTTTGGATAGATTTGGAGACCAAACTTTGGATGGCAAGGGACAAGAGATTCCGTATCGGGCCA
TGATTCGACACACGCTTGTTGATACGGTCGTTGGTATTACACTGTAGACGAAGTGATATCAACACGAAATGATTCGGTACAGTCATCCCAAGCAACCAGC
AAATGAAAATGGCGTGTGGCCCAATACACTTTCGAATGCTGTTCTTGATCATCTCGGAGCGCAGTCAGAATTTTACCGAAAGGCTCCTTTAATCGACAGA
ATGAAACCATGATAAGTTAACAAGGATTAATTTCTTGACCATCCATTCGTTTTTAGCCTTGAAATTAAGTTGCTTTATACCTTCGACTGTCACCTTTTAC
CTAAGCTTAATTCTTCAGGATAGGGGCCAGGTGCTTCGCGGCGAAAGCACAACTGTTGCGAAtggcaccttcagcagcaggactCACAGCCGTCGGCAGC
ATCACTGGGTCGTGAACGAtgttctccagcaggtccAACTCAATGTTCGTGACACCCTGGGCATCCGCGTTAGCCTTGAATCGCAGACCCTGCTCGTAGA
AACGCTCAAGCATGCCAAACTGCACAAATGTAGGCGGCAGGTCCTTTAGGTTCTGGTTGATCGGGGACACCTTGAAACGCGGGTTCGGATCGTCGACGGA
GCTCAGGTAAGCCTCGAGACTGCTATCCAAGAAGTTTGCAGTGATCAAGCAGTGCGGGGTAACGTCGTCACCGCCGGTTTCGGTGAGGTCAACCCAAGGT
GAGTAGCAAAGGGCGGCGGCCGGCTTCAGCTCTGGGGTAGTGTCACGAAGACGCATGCAGTTGGTAAGGGTCATctcgccaccagcactgTCACCGCTCA
GCACAACGTGGTTGGGGGCGATGTTCTCGTTGTCAAGCACGTATTTGTACATCGCGAAGCAGTCGTCCAGAGCAGTGGGGTACACGAACTGAGGGGCCAT
GCGGTAGTTAGCAAGCAGAACATCAACCGACACGTCGAGCTGGTACTTCTCCTTGAggatctgcttcagcttggtgTGGGTCTGATTCGCGagctccacg
tcctgcagcgGGTCGGACACAACGTAAGCACCTCCGTGGAAGTGGATGACCACAACTCGGtgttccttcttctcgataTCACGGAACCACATGTGCTCCA
TTCCGTtggccaccagcttctccgggACGGTGCCGTGCAGGCGGCTGTTGGACTTCAGAATAAATTTGCCGTGAAGGTGGAATGGCATACGCAGCAGGTG
AGCGTTCTTGTTACCAACGAGGTGGCCGTAGTCGGCGAACGTGAAACGCATCATCGAGGCCGTCAGCTCGTAGGCCAGCGTCCATTGCGGGAAACGTGGC
TTGAATCCGCGGGCGGCGTACGCGAGGAGCAGGTACAcgacctggagctgcaacttgaTCGCGATGaacggcaccagcaccgggTTGCTGGCGTACGGCA
CCGCAGCATAGCAGAATCCGGCAAAGCCCAGCACGTACACGACAACCACCACCGCGACAATGATTTTCAGTGCCTCACCGCCGAACAGAATGATGAGCAG
CGCAATGATCGCAGCGAGCACAACGGTGCTAAGTGACACCTTGAGCGCGCTCGACTTGGCACCTGGGAGGTTCTTGCCGTTCACACCGTCTAATGCTCCG
TAGCTTGACGTCATCTTGTCTCCGTCCACGAGCGAGGAAAATGAAATCTGACCGCACTTCTGCGAAGGCGGAGAGCGCTGGCGGAGGCGGGACCCCATGG
ACGCAAATCTCGGTGGTAATCTCGCTTTCGTGTAGACGTGCGTGCAATGCAGTTCACTCAAACGTACAGAGGAGACCTTGTGCCACAAgtggtggccgtg
gccaCACATCTGTCGGCGATAAAAAAGGATAAACGGATGAGGAATGTGGTGTGCCATTTTAGGACGAGGACGAATGCACCAAGCAGAATCGTTTTCGACG
CCAGTTATTAAATAGACGTGTCTACAGTAGGTAGTCTTCGAAGTACACCTGGGAAGTTCCCAGTGGGAACACTTACTTCACCTGTCACTGACAGGCTGTC
AGAGGTATGAAAAATGATCAACATATGCGTCACATCCGATAGCCCCATCAATCGCATGGCGAATTGTAAACGAGAGTGTTTGGAAAACACGGTTCACAAT
CGGGGCAACTGCTTATCCCTGATGGAGCCCAGCTCACCGATCACCGATTGCGCTGGAGTAAGTTATTTATAAGTTACCTACAGCATGAATATTGCAGTCG
AATCGAAAGAATCGGCATCCTTGTCAATGCTTGCCGTCGTCAAGTACATCCATGACGAGCATTGTGCAACATCGTGATCTGGGAGTTCGCACTGGACATC
GCACCCGATTAAAATCAAATTCCCTTTTAAAAATTAAAGACATGTGTGGTCGATTCGAGTCTCTGGCAGTGGAGGGCTACAACTTGGTCATCTTTCCGTG
TGGCTTGATCTATTCCTGTATCCGCCGCGTGTTTTCGCTTAACGTTACGATGATTCCGCCAAATTCAACAAAAACGAAAAGAGTGAGCTCAAAGGCGAAA
GTCCACCCCGGGAAGATACGCGTAAGAAATTAGCATCGATACGagcttgcactgcaacttgacAGCAATGCACGGAACCAATACAAGCGAAGTGGTCAAA
GCCTTGCAGCGTAGCAGAACCCGGCAGAAACTACCAGAGACGTGATGATTAGCGACAAGAATAGGATCGAGACACTGAGATGCAGCATCCCCAAGTACGC
CAACGGATTTACGACAAGAGCCGCGTGGAAGTCGAGCCTCACCAATGCACTACTCATGGTCATTCTAGTCGCGAGGCACCACATGGAAGTATGATACGAG
AGCAGTCGACGGTGGACCCCCAGTGATCGATCCATCGAGCTCGATTCGAAATGAATGCTGGGAATGGATGATGCAGCATCCTGGATGCTCGTCAGTCTGC
ACACAACTGCTTAGTGCGATTGATTCCTAATATCGTCCTAATGCATTGTAGGTCGGCTACTAGAGATTTTTAGTTGTTGGATTAACTCTGCGTTTTGGAA
TTAATTGGACAGAAAACGTATTAAATTCTGCTGATCCAAAAATAGATTCCCGGTTGCTCACTGGAATATCCTCGGGTAATgtatccgtaatttatccaaG
CTTTtatattttttatttttcttgTTCCAATCCGCCAAGTTGGCATGGCCAACTTGGCGGGGCACAAGGCGTGTCTCCTAACAAACAACTCGATTGAGAA
ACAACATTGCCTAGATCTTCTACTTGCTATTGACATTGGATTATCGGATCTAGGATTCAGTTGTACATCAAGATTGGTCACCTAGCATTCAGCTTCCGGT
TCGGGCTCAGCGCACAGGAATTTTGCGGCAAGCTTGGCAGCGAACTCGCAGCCGTGACGGATACCTTCTTTAGCTGCGGGATTCACATCGGTCGGTAGCA
TGACGACGTCGTGAGGCATGTTCTCCAGGAAGTCCACCTCCCAATTGGTGACGCCCTGCTCCTTTGCCTTTGCGATGATCCGCTTGCCCTGCTCGTAGAA
GCGCTCAAGCGTTCCGTATTGGACAAACATGGGCGGCAGGTTACGAAGATCGCGGTTGATCGGCGACACCTTCAAACGCTCCTCAGGGTCCGTCACCTTG
GCCAAATACGTCTGGTGCACCGAGTCCACGAACTTGGCCGGCATGATACAGAACGGtgtcttctcgtcgcctccCTTTTCTTCAAAATCCACACTCGAGG
AGTAGAGCAGACAACCGAGAGGAAGTTGCTCCGTTTTGTTCGAGTCACGCATCCGCATGCAGTTGAAAAGAGACATCTTGGCGCCAGCGCTGTCTCCGCT
GAACAGGACATGCTTCGGCGAAATGTTTTCGTGCTTCAACACGTACTGGTACATTGTGAGGCAGTCATCGTCGGGTGTCGGGTACGGGTTCTCCGGGCTC
TTGCGGtagttggccagcagcacgtccaccGACAAGTCGAGCTGGTACTTCTCCTTCAAAATCTGTTTCAGCATCGTGTGCGTTTGgttggccagctcca
cgtcctgcagcgGGTGTGACAT