Description :
From Genome Similarity Track
Location :
Scaffold_1270:1769- 3894
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1270-fgenesh-gene-0.0Reverse transcriptase

Sequence
2125 bases(100 bases per row)
CCACCGTCAAGCGGATGAGGAAGCAGATCAAGGACGGTAGCTTCGCGCCCAAGCCTCACGGTGGACTACGAAATCAGAACGCAAGTACAATTGACGTGCA
GTGGCTGGTCAGCTGGTACAAGGAATTTGCGGAGGAACTTGCCGAAGTTGCGCCTGTGCATGTGCGCCGGCAGACAACGGTGGGCGGTCTCGTCAAGCGT
GTCTACTCGCCCGCGGACTTCCACTTGCTGCCTGCGTATTTCACGTGGGAGAAGCTGCACGACGAATTGGTCGCTTATATCGCCGAGAAGGGGCTCTCCG
TGCGCGAACCAGCGCTTGCAACAATGCGGCAGCTGCTTGGCAAGCACTGCCCAAACATCCGCATTTGTTCACCACGTAGCAACGTGTGTGACGTGTGCGC
GATTTACAGAGCAACAATGAAAGGCGGGACGACAGCAGACCTGACTGAGACCTTCGGAAAACACACGATGGCAGCGCGCCGGATGAGGTATGTGGATGTA
GGGTACAATTTGTTTTACTCTATGGAGATTGTTCTCAATTTGTTTTTCGGTGAATTGTTTATTAGGCAGGAGTATCATAAGAATCTGGAAGCCGCAGATG
ACTCGCATGCAGTGCTTATCATGGACTACAGCCAAAACCTCACGCTCCCGAGTGTCGCTACAACACCTTCGCAATGGTATTTCCTGTCACTTTGGAGCGT
CAGCATGTTCGGGATTTATTTTGCGAACGACAAGGTCCAGCACAACTACCTCTTCGAAGAGCGCACTGCCGGCAAGGGGTCGGACGAGGTAATTTCGATG
CTGCACCACTTCATCACGGAGATCTTGCTGCCCCGCGCGTACTCGCGTGTGACCATCTATGCCGATAATTGCACGGGACAAAACAAGAATAGCTACGTTG
TCAAGTTCCTGCTCGCGTTATCACACATGGGGGACTTCGAGGAGGTCTCCCTCAAGTTTTTTGTCAAGGGTCATACTAAAAACGCTGTTGACCGAGGCTT
CGGACATGTGCGCAAGTACGTCGAGCGCCAAGATATCTACACGATGGACAAATTGATCGAAGTTGTGAATGCTGCGGCAGTGTCGTCAACTACGGTGCAT
TTCACCCCAGAAATGCATGCGTTCAAGAATTACAAGCTCGTTTTGACTGACGCGTACAAGAATATTCCTGCAATTCGCAAGTTCCAGGTTTTTACCATGC
GAGATGATAAGCCAGGGACTGTCAGCTGCTACGTGGATCCAGATAACGCGCCTGTTGTCTGTGACCTGCGACGCCGGTACGACGGCATTGACACCAGCGA
CGATCGAGTCAGAACCATGTTTCAGTTTCACCTGGATTTACTCCCACCTCCGCAAGTTAACACAGAGAAGGTAATTACCATGCACACAAAGGTCCGCCCG
TATGTGCCACCGGAGTTCCAAGACAATAGTTCCAAGACAATACGCTGTACGCTGCTCCGACAGCGGAACAAGAGCAGACAGCCAAGGCGGTCAAGCAAGC
CCGAGCCGGAGCGCGCAAGGCTGCAGCATCAGACGTTGCCACGGAGAAGTATTCGACGGAGGCAGCCGTTGCTAGGGACGAAGCCAAGGAGATGGATGTC
AGCAACGTTTTCGCAGGTACAGAGTCCACGCCGCCTTATGGTGCAGCTCAAGCGAAGCCACAATCACCTGCCCGCAAGCGAGCCAGGAAGGGCATTTAGA
TGTCCCGAGTAAAATTAAAATGATCCTAATGTCCAAGTGACCAGTCAAATGATCCCAATATCCCACACACCAACAACCATTTTCGACACTGTCAACAATT
GACGGCTTTGTCAAAAACTCAAATAAGTTGCAGAAGGATCCCAAATTTGGAGGAACTGATGTGCTCAATCGATTCCGCGCCAAAAACTTACCAAAGTAAA
CTAGAAACCCAAAATTGTTTTTTTATTTTTTGAAATGGATGTCTTTTTTGAACGACCTTATCTTGGCAGGAAATTTGAATTCTTGGACACCGGGCATACC
AATCGACAGTAGAAACGAAGGGCTTTGCGTTGGCGTGCTTAAATCGCAATTCGTACTTTGGTTGATAAGGTTCATTTTGTTTCACGTGCCCTCATTTGTA
TACAAACTGTACAGTGAACTGTACA