Description :
From Genome Similarity Track
Location :
Scaffold_350:1769- 3423
Sequence
1654 bases(100 bases per row)
AGCCTCATCTCCAACCAGATATATCTTCAGACTGGATATCCGTTTTTCTTCGTCTTGTGCTTGCTTAATGTGATCGATCTGTATCCGCCGCACAACTTCT
TCCTGTAAAATCCTGGGCTGAAATTGTCCTCTTAGAGCTGATCGAGTGATATCCGCCATTTTTACTGCATGATCGACTCGCTCTGGTAACAGTCATTATC
CTAAACGATTGAGAGTGATCAGGTCTTGACGATCCTGATCCGAAATGACAACTTTTCCTTTCTCTTGCCTTAGAGCTTCACTCGCCAGCCGATCTGCACT
CTGATTCTACTCCCGCTCCATATGCAGGATTTCATGGGCTAGCCACGATCAGAGTATCCCCATCTTTCTCTGTCTCATCAATAGCAGTCTTGGTGCCTTA
CAATCGATTTCTCCTCGTAGTTTGGCGGATAACTAAATTTAAATCTCCGCAGAAAATCACTCGTACCCTGGCCTGACCGGCAAGCAAATCGAAGTTGATA
AGTAATCCTCGGTATTCTGCTTCATTCACGGTCAGATCAGGGGTAAACTCGGAAGCAGCCGCTAAAAATGTCCACTCCGGCAATTTTCATATAATTGCGC
TGTATGCTCCGCCCTTTCTCTTCACTCTAGCCGATCCATCGAAATTGGCCACTAGCAAGTTTTCATTTTTTCCTAGTAAAGGTGGTGGCATTCTTATCGT
CTGTCTTGTTTGCTTCCGCGGTGCAATCGCAATCAGTACCTCATCCACTTTTGATCAAGGTTGAGAATATGATTGGAGATCGAGGGTGATCGACGAGCGA
TCAAGGTGATCGAAGATCAGAGAAATTAACGATCGATCAAGGTGATAATCGATCAAGGGGATCGACGATAAATCAGGAGTGGACCTCGACTGCGAAGGAA
CGATCAACGGAATGCAGAAGACACGTGGCAGCATACCCTGGTATACATACAGGTACAATGGTTTTTTGGTTGGTTAACATTAAACAGGATTCTATTTGCT
TCTAAGTACACGTGTCGACATCTCTTACGGGCTGGAATATTGGCCTCCCGACGTCAAGAAGGTCGCGCATACTAAAACCAAGTGATATCCCTAGATAATT
GGCTGGGGATCAAGAATTCTCAAGACAACCCCAACTGCGATTGGACGCAGCAAGAACGTAAAGGACAAGGCGCAAGATCGCGAGATGGCTTAAGTGGTCA
GAAGGCTCGCGTATCAAGCATCCACATAGTGGACAAGGCGATCTCGTTGAGATCTAGGTGGCTTACATCAAGTAACCTACCGGCATACCCGTGATCGTGT
AAAGATTTCCGCACGATTACAATCCCCATACCCAACACGTTCAAGATTTCCCTTGATACGAGTCCACCGAGAAGGGTGCAGTCCGCCCTACCGACGGGTA
CACAAGGTGAGGAAGGAAATACAAGGCACAAAAAAAAGTACCACCTCCTATATTCGGTCATCTGGGCACCAGTGGAGAGTCGGGGTCGGCTCATAAAAAT
GAGCGATCGTCATTTCTCCGTAGAATTATCTTTCATTTATACGTCACTTCCAGAAAACGTAGAAAAGAATCGAGTTTGGAATAATGCTTAGCGGTCGCGG
TTTGGAAAGGGTTAATGGGCCGCATTCATATCAGTGCAAGACACAGGTGATATT