Description :
From Genome Similarity Track
Location :
Scaffold_87:176802- 179226
Transcript NameFunction/comments
Aphas_H257_16807phospholipidtransporting ATPase putative

Sequence
2424 bases(100 bases per row)
GGTTTGTCGGGTTTGGCCAATACTTTCTGCTCATGTACCAAATCATCCCCGTGTCGCTGTATGTCACGATTTCGACGGTCATGTTTTTGCAAGCGATCTT
CATGTCTTGGGACCTGGACATGTACTTTGAAGAGCTCGACGTCCGCATGATTGTGCGGACGATGGGGCTCAACGAAGAATTGGGCCAGATTTCCTATGTC
TTTTCCGACAAAACCGGCACGTTGACGTGCAACGTGATGGAATTCCGCAAGTGTTCGATCAACGGCGTCAGTTATGGCCTTGGCACGACGGAAATTGGTA
TGTTTTTCACCAAAATACCAACTTTCTTGCTTTATTTTTCGTTAAGTTTTATGATTTCTAAAGGTCGAGCGGCGCTGAAACGCAAGGGCCTCCCCGTGCC
TGAAGTTCCCGTGTCGAAAAAAGGGGCGAAAGTGCCCTATGTGAACTTTGAAGACCCGAGATTGCACCAGAAATTGACAGCCATTCCGTTAAACAGCTCC
ACCAACTGGACGAAAGAAGCCGAATTTTTCTTGCACTTGGCGATTTGCCACACGGTGATCCCAGAGCAAGCAACCGACAAGCACGGCGACGCGGTGCTCC
GGTACTCTGCGTCGTCCCCGGACGAGCAGGCGCTGGTGTCGGCGGCCAAGTTCTTTGGGTTTGCATTCGAGTCGCGGGGCTTGGGCGTGGCGCGCGTCCG
CGTGACCAACAAATCACTGCAGCAGGACCCGTCTGCGTCGAGCGAGTTGTGGGAGTTCAAAGTGCTGGACGTGCTCGAGTTCAACTCGGACCGGAAGCGC
ATGAGTTGTGTGGTGCAAGACCCGAACGGGGCGTTCATGTTGCTCACCAAGGGCGCGGACAACGTGATCACTCCGCTGCTGGCCAACGACAACGACGCGG
ACGTGGTCGCGGCGACGCTGGAGCAGCTGCAGACGTTCGCCGACGACGGCCTCCGCACGCTCACAATCGCCAAGAAGGTGATTCCCACAGCGTACTACCA
CCAGTGGACCAAGCGGTACAAGGCCGCGTGCGCGTCGCTGGACCAGATTGACAAGCGCAAGAATGGCCACCCGAACGACATTGACGCGTGCATGGTCGAG
ATGGAGCAAGATCTGGTGCTGCTGGGCGCCACGGCCATCGAAGACAAGCTCCAGGACAACGTTCCGCGCGCCATCGCCCGCCTCATGGAGGCCGGCATGA
AGGTGTGGGTGCTCACGGGGGACAAGCAGGAGACAGCAATTAATATTGCGTACGCGTGCCAGCTCATGGACAACGACATGATGCAGTACGTGTTCAACTT
GGACGAGTACCCGGACCTGGCGTCGCTGCGCGCGAGTCTCGCCTTGTGTGTGGCCGACCTCGACCGTACGTGGCCTCGAGTATATATATATAAGAGAGAA
GAATATGATGGGGAATATATATATTTATATATATATATATATTTATGGTTGTAGAAGTGGAAATCACGCGGCGGTCGCTTGTGATCGACGGCGATGCGCT
CGAAATGGTCATGGCCGACACAGATGATGCGTGTGCCATGTTTTTAAAAGTCGCCATGGAATGTGCGTCCGTCGTGTGCTGCCGCGTGTCGCCGTCTCAA
AAGGCCGAAGTCGTGGGGCTTGTTCGGGCCAACAACGTCAAAGCTCGGTACGTCTTGGTCCTATATATATACATATATATATATGTCATATATGTCATAT
ATATGAAAAAGAAAGACAACGAGTTTTTTCCATGGCCAATAACAGTGTTTGATACATACATAGCACGCTCGCGATTGGCGACGGCGCCAACGACGTGGCG
ATGATCCAGCGCGCCCATGTTGGCGTCGGCATCTGCGGCATGGAAGGCATGCAAGCGGTCAACTCGAGCGACTATGCGATCGGCCAATTCTATTTCCTAG
AAAAGTTGCTGCTGCACCATGGCCGATTGAATTACGTGCGCATGTCCAAGTTGGTCGGGTACATGTTTTACAAGAACATTATGATGGCTTTGGCCCAGTA
CTTTTACTTGTACACGACAGGTACATACATATATGACACTATTTTGGTCAAATAGGGATGTGTGGACAGTATATTTGTCTGTGTAGGGTCATCGGGGCAA
AAAGCGTACTCTGAAATTGCATTCCAAGCGTACAACTTGGCGTTTACGTCCATGCCTATTGTGGTGCTCGGCGTGTTCGACTACGACGTGCCGTGGGCGG
TCGGCCAGCGCTTTCCGGCGCTTTACAAGCCAGGCATCACGGGCGAATTGTTCAACACGACGGTGTTCTTCAAGTGGATTGCCGCGTCGATTTTCGAGTC
GGCCGTGATCTTCATCGTGACTGTGTACGGGTACAATCAACTGGAGCAAGGCCTCGGCAGCGGCGACTTGCAGCAATATGGCATCCTCCTCTTTGCCCTT
GTCGTGTTTGTGTGCAACTTCAAG