Description :
From Genome Similarity Track
Location :
Scaffold_92:17680- 27936
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_92-fgenesh-gene-0.14Protein H39E23.3, partially confirmed by transcript evidence
Pytir_DAOMBR486snap-pir_contig_92-abinit-gene-0.107Pentatricopeptide repeat-containing protein
Pytir_DAOMBR486maker-pir_contig_92-fgenesh-gene-0.326S protease regulatory subunit S10B
Pytir_DAOMBR486maker-pir_contig_92-fgenesh-gene-0.4Amino Acid-Polyamine-Organocation (APC) Family

Sequence
10256 bases(100 bases per row)
GCTTTGAAGACGATCTTCTTTGCAACAGACGTACCAGTAGTCAACTCCTCTTTCGATTTCGAAGCCACAATCTTCTTCGCAGAGCTGCGCGTTGCCCGCG
TCACCGAATGGAGCAGGTTGTCCGCCTTGGCTTTCTTCGCCTTGTCGTGCTCGTAGATCGTCGGCTCTTTCGCGATCTGCTTTGCGTGGATCACATCAAA
CTTCTTGCTGCTGCTGGACACTTTCGCGCTGCTTGGCATCTTCGCGACTGGAGTTCTCTTCGCAGGGGTGTTCTTTCCCTTCACGTCCGACTTACCCACC
GAGCTAGCTGTCACTCGCTTCATTGGCTTTGGCTGCGGGGTATCAACGCTCTGCTCGGCCTTTTCGGCTTCTGGCTTACGCTTCGAAGGCGCCGCAGCAT
CGGACGAAGCGCTTTGCTTGCTGTCGGCGTCAACAGTCTCTGTGTCCTCCTGCTCTGGCTTCGCACTATCGTCCTCTCCAGTAACAGGAGCATCTTTCAC
TTTTTCATTCGAGTCTTCCACTTGCTTGTCGGTCACTTCACTTTTCTCACTGCTACCAGCACCGTCAGCATCACCGTCTGCTGCAGCCGCCACCGCTTTC
TCGTTCAGCGCGGGCGAGTCGTTGAGCTCGCTCTGCAGCTCAGCAGCGTCGCCCTGTTCGGCCTTCTCCACGAGTGCGCTCACCTCCATCGCTTCTTTAG
CGCGTTGATGTGTTGATGTGTTGATGTGTTGATCTGTGGGTGTGGATGTGTCTGTGTCTGCTGGTGCTGTTGCGTTCGGATGGCTCTTCGCGCCTTCTTC
CGCTTGTCAGTCACTCGCTTGGCTTCAGGCTTGTTGTGCTTTGTCTTCCGCCCTCTAACAAACAAACAGACCGAGACCAGCCGTGCCTCTCTTTTCAAAA
TTCAAACAGTGCTAAAATGCAGTTTGCTAATCACGCACCTAAAAATGAGGCTTCGGGTCATGAAAAAATGGCGCCAAATTCATTTATGTCCGATATATTA
GGTTCGGATCCTTTCCTCTTTAAGTTCGTTTCTCAGAGCTCAGATTGCCATTCACAGAAAAGGGCAATGTCCACTTCAAATAGGAAATGACTCACTTCCC
ATGTCCAGTTGCAGTTTGCAAAGGCAAAGGACACAAAGCACACATTTTACTATAGCTCAGTATTTAAAAGCTTCTTGCTTTATTCAAGATAAATGATGGG
CTTTTTAAATGCTTGATGAGTGAGCAGTCCTTGACACATCACTTCTCCATCAAGAGTGATCTCAATTTTTTCCGACGCTCACCGCGTCACCGCGCTTGAC
GATTACTAAAAATTTGGCCAAGAGCTACACAAGACACTTCCGTCGCAATGCAGCGCATGGAGACCGGTGGCGGTAAGCACGCTGGCGCGCTAGCCGCGCC
GGCGGGAAGGAAGCGCTACGTGACGGCGCTGCTCTGCCTCTGGGTGACTACGATCTGCTACGCCGACCGTACGTGCTTGACTGACTGCCGCCTGTCATCG
CTGTTTAACGCGACCTCTCAGGTTCAACGTATGCTGATTTGGATGAATTAATGGATCAACTGATTGTGATGATAGGCACGAACATCGGTATCGCGCTGCC
GGCCTTTGTGGACTCGAAGGAAGAGCAGGGCCAGGTGCTCGCGTCGTTCTTCTATGGCTACATGGCGACTCAGGTTCGTACTTCAGCGTATACGTATTAT
ATCACAGTGATGTCGTCGTATTCATTTTCTTTCTCTTTATTCATTCGACTTCTCTTTTTTACTCGATTGCTGCACCTATCAGATCGTGGGTGGTTACTTC
GCGACCAAGCTCGGCGCCAAGGTCGTGCTGCTCACGGGCGTCGTTGTCTGGACGCTCTTTGACCTCTCGACCGTGTTCGTGGCAAAATGCACGTGGTGCC
TCTTCTTCGCGCGCGCTGGCATGGGGCTAGGCGAGGGCATCCTCTTCCCGTGCATGCACCAGATCTCCGGCGCGTGGTACCCGATGCAGGAGCGCAGTCG
ACTCGTGACGCTGGTCTCGAGCGGCAGCGATCTCGGCACGATCACAGCGCTCATCGTGTCGCCGGCGATCCTTGAGGCGAGCGGCTGGCAGCGCATCTTC
ATCGTCTTCGGCGTACTGAGCTTCATTTGGGTCCTCGTCTTCCTTGTCTTCGGCGTCAGCAACCCGGAGCGCGACCCCACGATCTCGCACGAAGAGAAAG
CCTTCATTCTCGCCAACCGCACACTCGACCCCGTGAGCCACCGCCGCCAGTACCAGAGCAGCGAGACGATCGAGCATGAGGCGCTCAACTTCCGTGTGCT
GCTGACCTCGCGTCCGGCGTGGGCGATCTATATCGCGCACTTCTGCTACAACTACAGCTGGTACGTATTGCTTGGCTGGATCCCGCTCTACTTCCGCCAG
GTGCTCAACATCGACCTCGGCAAGAACGGCATCTCCGCGGCGCTCCCGTACATCTGCGGCTACATTGGCACGCTGCTCTTCGGCCGCCTGGGCGACATCC
TCGTCGCGCGCGGCTTCCGTGTGCTCCACGTGCGCCAGTTCATGAACGGCTTTGGCTTTTTCGGCTCGGCAACCTTCCTCTTCTCGCTGCGCTTCGCGAC
CAACGCGCCGAGCGCTGTGGCACTGCTCTCGCTCACGCTCTACTGCAGCCGCGCGTCCATGGCGGGCTACTGGGTCAACATGATCGACATCGGCCCCAAC
CACGCGGCACACGTCATGGGCGTCTCCAACACGTTCGCGACGATCCCGGGGATCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCCTCGCGGCCA
CGGGCCAGTGGGACGTTGTCTTCGGCATCGCGTCGCTCGTGCTCGTCTTCGGCGGCCTCGTCTTCCACTTCAACGCGTCCGACCAGTCGATCTATAAGAC
CGGGTCGGGCGGCGCGAGCAGCAACAGCACGAGCGGCAACAGCAGCCCTGAGTACGGCATCCGTGCACCACTCACGCCGAAAGAGGAATTGGTCGGACTC
CTCCTCGACGAAGAATAGAGAAAACGCTCTGTATGTAGCTTGTTGCTCTGTCTATAGCTTTTGTTTACATTCTGTATGTATGTAGCTCTTTTCATTCTTT
CATTCATCTCTACAGCTTGTGGCGGCCTTCGCTGTACCGCCCGAGTGCGATTTTCTGTAGTTGTGTGGCTGAAATTTCATCTTTTGCACACTTTTTCTGC
ATCTCGAGAAACAAATTGGTCGCCACCACCCACGCCTCGCGCTGCTCGGCAGCGTAGATCGCTTCAATGTAGCTCTGCGACGTCGGGTAGATCCGGTACG
CGGCGGCGCTCCGCATGGTCGAGAAGATCTGGTCCACAAAGTGGAACTCGCTCGCCGCATTGCACATTTCCATCACGCGGTTGAAAAACACCACGTTCGG
ACGCACCCCATAGGTCGCTTCCACGTCACGCAACACCACCACCGCGCGGCGCCACGCCCCCAGATCATCCAGCGTGTTGAGTAGCTGCAGGATTACGCGC
GGCGAGACAGATCTGCCAGTCTCCGAATGCCACTCCTGGAGAATGCCCATCAAGCGCATCACGCGATCAAGATTGCGCGCGCGGCTGCAGGCTTTCAGGT
AGTTCTGGAGACTCGACTCGGAAAGGAGCTCAACGACTTCACTGGATGCACTGCGGCCATTGCTTTTGCTGTGTAGTAGCTCATCAACAAACTGGAGCAC
TCCGTCGGTATCCCCACGCAGCGCACACGCTGCGAGCACGCGCGTGTACGTGATCGAAGACGGCGGGACGCCATTGCTCTGCATTTCGTCGAGGAGCTCC
ACCAACAGATTCCGCACGCTTTCAGCCTCCGCGCGACGAGTTTCGGCGTCAGCAACGTTGAAAAATTCAGGTTCCTCTTTTTCAACACTGTCAAAAGCAT
CTTCACCAGCAGCTCCAAAATTCTGGTCGTCATCATCAAAGTCACCACTTTGTTGGTCGTCCTCTTCGTCATCGCCCTCGTCATCGCCCTCGTCATCGCT
CTCGTCATCCTCAGCTTGTCTGCGCACCTTCGCGAACGCCTTGAGCACCATGTTGTAGGACACAGCGTTCGGAATCAACCCTTCGTGCTGCTGCATGTGC
TGCAACACGTCTATTGCTTGGAATGACGCACTGTTGACAGCGCACGCCTGAAGCACGCGATTGTACGCGTCAAGAGAGGCAAATCCAAGCTGCTGCTTCA
TCGCATGGATGTACTCGAGCGCCTGCGCGACATCGCCCTGGCGGCCAAACGCGTGGATCAGGTTCACAAATGTGGCTTCAGTTGGTTTTAGAAGACCCGA
CGACTGGATTCCGTTGAACAGCTCCAGTGCATCGTGCGGAGAGCTCGAGCTGGCGCACAGCTGGATCGCGCCATTTAGCACGTCGATCGTCGGGCTGTAG
CCCTGCTCGTCCATGAGGTAATGCAGAAAATTGAGCCCCACGTCGATCTGTTCCGAGCGACTGCACACGGCAAACAGCAGGCTCAGCGTCATGTCATTCG
GCTCGAAGCCTCTCTCTTTCATGGTGTTGAACAAGTCGAACGTCGATTTCATGTCCCCCAGGCGCTGGAAGTAGTCGATCGCGGCGTTAAACACTGCGAC
GTCCAGGTTTTTCACAGGCGCGTCGACGCAAACTCGCTTGATTAATAAAGAGATCTGGTCGTGGATCCCTTCGTCATTATCACCGTCTCCGTCTTCCTCT
GCGCCCTCCTCAAACGCAGTGATCCTGTCTGCTTCCTGCACAAAAGCGCGGAAAAGCGAGAAGTACGTCGCTTTCGAAGGTTCGATCTTGAGCTTTCTGG
AGCTTCGCTGGAAGAGCTTGAGCGCACGGTGGGCGTAGCTGAGTCCTTCCGGCTTTCCTTCTTCTTCGTTTCGTAGGTCTAGATGGTGTCTCTGAGACAC
CTTCTTCGTCATGCTTGCATAAGTTTTCAGCATCGTGTTGATGGTGACTGCGTCTGGTGAAAGCCCGCGAGCCTTGAGTTTTGCATAGTAGCGCTCTGCC
TTAGGCACATCGCACTTAAGCGCACAGCAATTCAGGACCGCGTTGTAGGAGAAAGTCGACGGCGTACATCGCGCCGCAAGCTTCATCTTCTCCAGCACTC
GCTCTGCCAACTCGAGTCGTCCATGTCGACTGCACATCGCTAGCACGTTGTTGAAGCTCGTCGCATCCACACGCTGCCTCTCGATCATTTCGTCCAGCGT
GCTGAGCGCCGTCTCGATTCTACCAGCGTGTCGTGACAACGCAAAGAGATAGAGGTTATAGAACTCGACTCCCAGTAGAACCTCGCTGTTTTCGTTGTTG
GCCTCCAGCTTCTGGCACAAACACATGAACTTCTCAACGTCTTCAATCAGAGCCGACGTGAAGATCCGCTCCCACTGCTTCAGGTTCTCGACTCTTCTCA
GGATCGACGACGCACCTTCGCCGTCTTCACACCCATTCTCCAGTGTGGCTATGATCTCACGGAAGACTCTTCGCAGCTTTTCTGGGCTCTGCTTCTCCTT
TTTTACCATCTCGTTCTGCTTGGCTCGTGCAGAGATCGGAAGTTGATGCGGAGCTGCAAATGTCCACGCTACAGCGGGCGATGATGCATCTTTCACTTCA
CACAGCGCAACCAACCGTTTTGTGACAGCGTTGCCACTGCCACCACTGTTGTTTTCTTGTGATCCTTGCATCAGATGCTGCACTCTCGCTGCATTCTCCC
AGTCTTCCAGCTGCCTGCAGGCGTCGAGCGTGGCGTTGAGCAGGTCGATTTCAACTTTCACCTGCATTTGCTCGTGCATTTCCTCTAGGAAATCCACTGC
GTCGCCCGTTTTCGCGTCCTGAAGCAACGAAAATACTAGCGCCGACTGGGAAATCGCGTCGGGAGTCAGATCAAATGTGTGGATCGCCTGGAGCACCAGC
GCCTGCGCTTCATGGGAGCGACCGCCCGCTCGGTTGTACACGCGCAGCATACAATTCACGACCTCGATAGACGGCTCCACGCCATCATGCAGCATCTCGT
TCCAGAACTTGGTCGCCATCTTCACATTCCCATCGCCCTTGGAGCAGCAGTTGATCGCATTTGCGTACGCGAACGGCCCCGGGGTTTTGCCTGCCTCGCG
CATTTGCTGGAGCACGTGCGCCGCTTGCTTCAGCTTGCGCTTCTTACTACACGCCACCAGCGCTGTGTTGAAGCTGCGCGTGCTTACGCGATTGAACGCG
ACCATCTCGTCGAGGAGCGCGAGCACTTGGTTCACATCCCCGCGTTGGCTCCACTCGAACAGCAGCGCATCATAGTTTTGTGTCCAAATGACAGGCTTGC
ACGGGTCAATCGTTGCATTCGATAGAGCACTGTCGCTGCTACTCGGCGCGCGCAATGCGGAAACGATCAGCGCTGCAGTGCGGACGTCCTTGCGATCGAG
AGCCACTCGCAGGTGCTGGTTGTAGTAGGTATTGCTCTGGTTGTGTTCCAATCCGATCACTGCCAGCAATTCTTCACGCGACGTGGCGATAGCAGCAGCT
GTGCCAGCAAAATCAGTATGCTTATTATTACCAGTCTTGTCATGAGCTCGATGGACTGCGTCTTGCAGCAGCACTTGCGACAATGACGCTGGAGCGGATG
GTGACGAGGAAGTCGCGAATGCCGCGCACTGTGGTGGGCCTGTGCATCCGACTGAAGACCTGCAACGTGATGCGCTGTGGAGCACGAGAGCTCTGCTGCT
GATGCTACCACTGCTGTTTCGCAATGCTCCAAGACGCAGGCAACGCTGCGCCTGGAGGAACGGCGCCGATGGAAGCCGCATGCTTCGTGTGGAGTTCTGC
TTTATGAGGTTTGCTCCAATGGCTTTGCCTCACAAATCGAGACAAATGTTCTCTAAAATGCTTAAATCTATATATTTATATATCACAATGTCTAAATAAT
GCTAAATAACCCATAGTAAATATATAAATATGATATATTCTATAATATAATATGTAAAGCTCAATTATCTTGAGAGACTGATTAATTAACAGCACATGTT
CATTGCAGTACTTTGTCTCGACATTTGAAGTGTTGGAAGCATATCCCTAAATTTAACCTCTCTACATTTCGAGATCCACTTGCCCCCCTTCCTTCTTTCA
CAATAGCCAAAAGCTACCAAAGCAAAAAGCAGCAACTGAAGAAGAGAAGTGAGCGATCATGTCGGCGTCCACGACGGAGGAAGAGCGCGCGCAGGTGCTG
AGCGCCTACAAGGCCAAGGTGCGCGAGCACAGAGAGATGGAATCTAGGTGCGTTGTCTTTGTGCTTTTATATACGTGGCTCTACGTGCATCTGCTGTGAG
TGGTGGGCAGAATGGAAGCAGGAAGACGGATCTTTTGGATCTTTTCGCGTTGTCAAGCGTTCTTCATACTAATAATCTCTCTTCTACCTATGAACATGTG
CACGCGTGTGTGGGCTCTGCATACAACTATATATGGGTGCGCAGAGTCAAGAACATGCGTGAGAACGTCAAGGCACTTGTGCGTGAATACAACAAGACGG
AGGACGACTTGAAGGCGCTGCAGGTGCGTTCCGCATGCGCAGTTACCAATGGAACTATGTGTAAATTCATAGACTGATCCGATACCCTCTGCACTTGTTG
CTGTGGTTATCATCTTGCAGAGTGTGGGTCAGATCATCGGCGAAGTGCTGCGTCAGCTGGACGACGACCGCTTCATTGTGAAGGCGTCGAGCGGACCGCG
CTACGTGGTCGGCTGCCGCTCAAAAGTGGACAAGACGAAGCTCAAGGCGGGCACGCGTGTTGCGCTCGACATGACGACGCTCACAATCATGCGCTACTTG
CCGCGCGAGGTCGACCCGACGGTGTACCACATGCTCAACGAAGACGCCGGCAACGTGTCGTTCTCAAGCATCGGTGGACTCAATGAACAGATCCGCGAGC
TGCGCGAAGTAGTGGAGCTGCCGCTGACGAACCCGGAGCTGTTCCTGCGCGTAGGCATCAAGCCACCAAAGGGCGTGCTTCTGTACGGACCTCCTGGCAC
AGGCAAGACGCTCTTGGCGCGTGCGCTCGCGTGCAACATCAACGCCACGTTCCTCAAAGTGGTCGCGAGTGCAATTGTGGACAAGTACATTGGTGAGAGT
GCGCGTGTGATCCGCGAGATGTTTGGCTACGCACGCGACCACCAGCCGTGCGTGATCTTCATGGACGAAATCGATGCGATCGGTGGCAGCCGATTTTCGG
AAGGCACGTCGGCGGATCGCGAGATCCAGCGTACGCTCATGGAGCTCTTGAACCAGCTGGATGGTTTCGACGCACTCGGGCAAGTGAAGATGGTGATGGC
GACGAATCGACCGGACATCCTGGATCCTGCGCTGCTGCGTCCTGGCCGTCTGGACCGAAAGATTGAGATCCCGCTGCCAAACGAAGCCTCGCGCATGGAC
ATCCTCAAGATCCACTCGGGTCCGATCACAAAGAAGGGCGAGATCGACTACGAGTCGATCGTGAAGCTCACGGACGGCTTCAACGGCGCTGATATCCGAA
ATGTGTGCACAGAGGCCGGCGTATTTGCGATCCGCGCTGAGCGCGACTACGTGCTGGAAGAGGATTTCATGAAGGCGGCGCGCAAGCTGGGCGAGACGAA
GAAGCTCGAATCCAAGATGGACTACAGCAAGGTCTAAGGAAGCTGTTTGTTTAAGCACCAGCTTTGTGTGTGAGAGGAGAGAACACAAAAAAGAGTTCAG
GAATTGAGACCGAACGAAGGATTGGGCAGCGATTGCGCTCGCGACATGGTAACAACGAAGAAGAAAAAAGCGAGAAAGTCGAAACGCAAACCCACTCAAC
TAGTGTGTGTATGTCTTTCTTCCTTGGTGCGTGTATCGTGCGTGTCAAGGCTTTGCGAGGAATTGTGGCCGTGTTGCCTGTTGATATGCTTCTCTTTGTA
GTAAATAGTCAAGAGTGTGGAAGTGGCGCGGCTCGCAAAAGCATGATGGACCTGTCGAGTGTGGTCGTGCGCGTGAGGTTTCAGAGGTAATAATACTGTG
GTGCATCATTCCCCCACGTGCTATTCTCCTACTTCCTACTGGTGAAGCCCCTGAGCCTCTGCACGAAAGCTGCTAATCCTGTAGGATTCCTTCAAGCGCT
TGAAGTTGCTTCAAGTCGCTGCTGCATGACTTGTTGCATGATGAGATGAGAGCAGTTCTCTCATGCTTGGCTTCCGCATTGGTTTTTGTTTTCTTTCCGC
TGTTGAGTTGGTGGGTGATGGGAAAGCCCGTCGGTTTCAGAATTGCTCTTCTCGCGATCTGATTGGCCAGAACTACATGCGTTCGCTGACAAATCCTTCT
AATGAAGGGTTTAAAACCTATATTAAGGCTTGCAAACTGCGCACACTGCGTCACGCGTCCCGCAACCCAATCACCACACACAATCTCTTCCGCACAGCTC
TTGCCACTGCTCAGCGCTCAGTGGCTAACTAAGCAGCTTCAAGCGAAGCGCACCCTCCATTTCATTCTCCCCACTCCTTGCTTCTCTTCGCCACACAGCA
GCAGTAGCATGGACTCCCCCTTCATGCGCGCCATCCGGCGCGTGAAGCCCATCGAACACTTCCAGCAGAGCAAGCACGCGTCGCTCAAGAAGTGCCTGAC
GCTCGTGGACCTCATCGCGTACGGTGTCGGGTGCTCCGTCGGCGCCGGAGTGTACTCGCTCGTGGGCGTCGGCGCGCAGATCGCTGGCCCCGCGATCTCG
CTCTCGTTCTTGATTAGCGGCATCGCGTGCATCTTCACGTCGCTCACGTACTCGGAGTTTGCAGCGCGCTTGCCGGTACGATTGTCTGCGGATGATGTTG
TGTCATATAGTTGGTGTGTGGGGTGTGCTAACGTCCTGTTGGTGCAATGAATGCTGTGATATTGATGCTATTATGTAGGTGACTGGCTCGGCGTACACGT
TTGTGTACATCACGTTTGGCGAACTGGCGGCGTGGCTCATTGGCTGGAACCTGACGCTTGGATACGGCATCTCTGCAGGTAAAGATCACACCTGCCTCTC
TACAGTATTTGCTATGTGCATGAGCATGAACGATATGCTGACAACACCGCTTGAACTTCTCTAGCTGGTATTGCACGAAGCTGGGCGGCGTATGCGGACC
TGTTCCTGCAGAACTGGGGCATTTACATCCCGCACTGGATGGTCACAACGGAGATCATGGGCATGTCCTGCAGTCTGCTGGCGTCGCTACTCGTGCTCGC
GTGCACCTTCATCCTGCTCGCTGGAGTCCACGTACGAAGAACAGTGTTTTGTATCA