Description :
From Genome Similarity Track
Location :
Scaffold_373:1768- 3293
Sequence
1525 bases(100 bases per row)
TGACGGGCCCGGCGAAGAACTGGTACCGCCAGCTGGGCCGATCGACGCGGAACAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCCT
GGGAGTATCGGTCTCTTGGCAGTATTACCATTCTCGCAAGAGATCAGACGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGCGGCTCTGCGTGCG
AGATTGAAGATCAAGGACTGAGATTCCAAGGCCCGCCGAGAACATGTCGAACACTTTATCGAGACGCTGGGCGATCCGGAACTGGCCGATCGGCTCACTC
TACTCCGGCTTGCGGACGCAGAAGATCTGTAGGAAGTCCTGCGCGCTCGAGAGCGCGCGAAGAGCAGACAGAAGCGATCTGCCTTTGGATCGAAGTATCG
TCAGAAGGTTCCGACCTCAGCATCGGCTGCTGCAACCAAGCGAGCCGTGCGTGTATTGAGGGTTGCTGGTCTTGGGTACTGTGTACCAGTTGTACCCATT
AACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGTTGATTATGGTGATTACGGTAAGTTGTTTACGCCACCGATGATTAGACGAGTAGGATGATTGG
ATGAACACCGGTGAGTGATGGTTGATTAGATGCACTAGGTGATAGGACGCAGGGTCGCGTGTCTATAACAGTAGGGTGTAAGCTCCAACAATTCAATCAC
TTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCGTCCGAGCTTCGTGTCCAAGATCCAT
ACCTTCCATCAGGTTATGAGCCCAAGCACCATGTCCTCTGCCCAAGACGCCTCGACCAAGGTCTCCATTGACAAGTTCAACGGGGACAACTACGCGACGT
GGAACCGCTACATGCGTGGCGTGTTCCTGACCAAGTCGACGTGGCATGTCGTGAACCGCGAGACGACGCCGAGCTTCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCACTCGACATGCTGGCGGACATCATGACGAAGCCGATCGCGGCGCCGCAGTTCGACGCGCTCAGGACGAAGCT
GGGCATCGTGGTCGCTGACGAGTCGAGTGGGAGTGTTGTCAAGACTGATGTGACGACGCCCCGCCAAGCGACCGTGTGACGCGAACGCGTCATCAGTGAG
GTCGGCGTGACCTTCACTGTGTGGTACCGAAATCATTCAGGTGATTACGGGACGATGATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGG
GCATCGACGTGGCGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCCAGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGA
GGTAGCACGCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTTGCATTTTGCCAACTACTGCTCAAGTGCTCTTCCTTTTTCAGTGAGGTCGGCGTGA
CCTTCACGGTGTTGTACCGCAATCA