Description :
From Genome Similarity Track
Location :
Scaffold_69:176791- 178882
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17610hypothetical protein
Phypa_INRA-310PPTG_17611hypothetical protein
Phypa_INRA-310PPTG_17612hypothetical protein

Sequence
2091 bases(100 bases per row)
GGGGGCCAAAATCACTGCAAACGCTTACGCTCCGCCCGCTATGGTGGTTCAAAGTATAAACACGCAACGGCCAATTACTTTTCCGCCTCCATCGCTTCAT
GAGCGACTGGGTCTGCCAGACTTTCCAAAGGGGAGGCACGTGGTAGGTGCTGTCGTGGACTATTTACCCAAGGCGCAGGAGGAGTGGCAACGTGCTCGTG
TGATGCAATGGGACAAGGAGAAGAAGATGCATCTCGTGCACATTGTGACGTCTGATCAGAAACTATGGGCCAAACTGGACGTGGACAATACATTGATTTT
GTATCTTCCGGACGAGGAGAATCGCGTGGATGGACCGATCGTGAAGCTCATTCGTCCAGTCACCCAGGGCGCCGTGCAGTGGCGTCCAAAGCCGCGTCAG
TTCGCACCAGCAACATGAATGACGTCGTCGATTTAGGAAAAACCAGGATGATAGCTGGTCGAGCATGCAGGACATAACTGCAAAATTTATCTATATCATG
GTGGAAACTGCTGGACCTTGCCTCAGTTCGCTCTATTACCATGTCGCTCGGTTAGGAAGACATTCTCGAATGAAGAATCCCCAACTGCCGCTAGGATATC
TAGCAGAGTTGAAGCTGCCAGCGTCTGGTCTCATTTGCGACGTAGTATCTTTGCTTAGGTTTGCCAGTTGCCAAAATGCACTGGAGCAAGCAAGTCGTGT
CGAAAATGCTCCGTTCGAACTGGGATTTGGTGTCGCCGCTGGAGTGGCTGGACTCTTTTCTTCCCTCACTCACGCACTCAACATCCGAGTGAGGACGAAC
CGATGGTGGAGACTGCCCAGCAAGAGCAGGAGGGTGAAGAAGAAGAGATGGAGACTGAGGACTTACCTACTGTGAAGTCGATGGCCAGCAACTTCTTCGA
CGACCTTCCCGTCGGCGCGAAGCTCATGGACACGCAGGTGCCTCCGAACGTGTCGCCGCCCAAGTCCAAGACCAAGGATGGCTACTCCTTCTTCACGTAC
GCGTAAAGCACGTGTCTGACCGCAGATGACCGCGTGAACAGCGCCCGCCGCCGCAATGAGGACTCAGCGGGGCGACTGAAGGCGCAGCACAAGCGCCAGA
TCGGCACCTGCGCCCTCGAGTCAACGTGGCAACGCGCGTCCGAGCAGAACGAGGGATCGCACGATCATAAGGTGTCGTCTGGGACGGTGGAGACCTTTGA
GCAGGCCTGGAAGCGCACGTCCTCCGATGTCGCCGAGGATCAAGCTAAGGCCCATGGCGCCAAGCAGAGCGTGTTGCCCGACCAGCCCCCGGCTCAAGAG
CTGCCTTGAATGGGTTGCATGTTGAAGTTGACTGTGATTGTTGTCAGACAAAGATGAGCGAGAGAAATCACTAACAAATGTATTCGTTCTTTCAACCTTG
ACTTCGTTGCCTTGAGTCGGCCCTTGACCTTCAATGGGCTTGGATCAACACAACAATGTTGCCTTCAATAACATACTTTTGCTCAAGTGTATCCGTAGTG
TTCGATTTTCCAGCTGTACCCTCACTTTCAATTCGGCAGTGAACACGTCGAGCCTGACGTGGGAACGCCAACTGACCGAAACGTGGAGATTCTCTTCGGT
GTGGCGCTGCAGGCCAACAAAACGCTTGAGAACAGAGACACCTCCACGCCCAGAATCCTACGCTTCCTGGGCGCGTAATACTGCGACAGTGGGGCGTGCA
ATCGGTTTCTGTCGCCCTTTTACTGCTACGGCTTTGAAGTTCACATGCTTCAGTTCCTATTCAGCCGCAAAGAAGGTAAGAGCAAGAGAGACAAAAAGAA
GAAGCAAAGCAAGACCAACGATATGCAGAGCAGCGAGCCCAGCCCATGTCCCATGTTCGCCATGGTGTGCGCCAACAACGTGAACCGCAGCGCCGCCGCC
CACGAGATTCTAAACACCGCAGGACTGCGCGTTTGTTCCTATGGCGCTGGACGTCAGGTGACGTTCCCAGGCAAAACCATCTCCGACGCGCGCACCTTCA
AGTTCCTCACGCCCTACTCGGTCATGCACAGCATCTTGGAGAAGGAGGATGCCGCGCTGTTCACAGGCAACGGCGTCCTTCAGATTCTGGA