Description :
From Genome Similarity Track
Location :
contig_49:176786- 178235
Transcript NameFunction/comments
g9701.t1POM66521.1 Phosphatidate cytidylyltransferase [Phytophthora palmivora var. palmivora

Sequence
1449 bases(100 bases per row)
GGAGCATCTCTTGGATGGCTCGCAGCACCTCCTGTTTCTGGTCGAGTGTCAACTGCGCCACGAGGTTCAGAATCAGCGCCACGGACGGTGTCGACGAACT
GCAATAGAGGGAGCAACACACAAAGCACAACAACTGTTAGCAACACGATGTAGCGGGCCGTGTGAACACTAGAGGAACGACATACCGAATGAAGGTATTG
AAGTAGACCGTCGTGAAGCAGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCTTCAGGTTGT
ACGTACGCTTGATTGCCGAAGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATAGAGTGAAACTGCATTCACGAACACAA
CCAGACAGCTCGTCAGCAATCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAATTAGACCCG
CCAGGTAGACCGGTACGCCGTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGTGGGTCGGGAATCAGCTTGAACTGTAGCAAAATAAAGAC
ATCAGTGTTACCATAAGCACGTATGCTGCATGAAGACCAGTGCTTTGCAGCATTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGCAGGTCAACC
AAGAAAACTAAAACGAACAAAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGCACTGGAAAA
AAAGGCATAAATCACGGTGCAAACGAAAGCACCAATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAAGAACGGCGTCTTAATGAACTTGCGACCA
AAAAGCTTGCCGCAGAAGAACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACAAGCATATGA
ATCCCGTTAGCAACTTGTGACAAGGTCAGGATATTTATTACATTCGTACCGTTGAAGATATTCGTGAGGACGTATTTCATCTGGAAGACGATCAAACCCA
GCGTGACAATGGTCCACGTGTATTGCCCTGCAAGCGAGAAATTCACAAGTTAGAATGTCTGCAAACTCAAAACGAGATTCCTGCCAACTTACCCATCTGG
TACTTGTAGTAACCTACCCAGTCAATAAAACCACATCGTTGACACCAAAATGTTCGTCGGCACAGCGTCAGTCGTTGAAGCAACCGTACGACAGCACAAC
GAGCTCAACATCAAATCTACAGTCACGCACCTTTCTTGAGACTCAGCACCGACATGACGAAGAGCATAGCGTACATGGTGAACGACACCCACGTGTGGTA
CCGCAGGTAGTGCACGATGGCAGGCGGCACGAAGCGAATCTTGCTGCTC