Description :
From Genome Similarity Track
Location :
contig_49:176777- 177780
Transcript NameFunction/comments
g9701.t1POM66521.1 Phosphatidate cytidylyltransferase [Phytophthora palmivora var. palmivora

Sequence
1003 bases(100 bases per row)
CTCAGCCTTGGAGCATCTCTTGGATGGCTCGCAGCACCTCCTGTTTCTGGTCGAGTGTCAACTGCGCCACGAGGTTCAGAATCAGCGCCACGGACGGTGT
CGACGAACTGCAATAGAGGGAGCAACACACAAAGCACAACAACTGTTAGCAACACGATGTAGCGGGCCGTGTGAACACTAGAGGAACGACATACCGAATG
AAGGTATTGAAGTAGACCGTCGTGAAGCAGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCT
TCAGGTTGTACGTACGCTTGATTGCCGAAGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATAGAGTGAAACTGCATTCA
CGAACACAACCAGACAGCTCGTCAGCAATCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAA
TTAGACCCGCCAGGTAGACCGGTACGCCGTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGTGGGTCGGGAATCAGCTTGAACTGTAGCAA
AATAAAGACATCAGTGTTACCATAAGCACGTATGCTGCATGAAGACCAGTGCTTTGCAGCATTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGC
AGGTCAACCAAGAAAACTAAAACGAACAAAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGC
ACTGGAAAAAAAGGCATAAATCACGGTGCAAACGAAAGCACCAATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAAGAACGGCGTCTTAATGAAC
TTGCGACCAAAAAGCTTGCCGCAGAAGAACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACA
AGC