Description :
From Genome Similarity Track
Location :
contig_49:176754- 178203
Transcript NameFunction/comments
g10169.t1OWZ18887.1 Phosphatidate cytidylyltransferase [Phytophthora megakarya

Sequence
1449 bases(100 bases per row)
GTGCTAATGCTGAGATGGTCTCAGCCTTGGAGCATCTCTTGGATGGCTCGCAGCACCTCCTGTTTCTGGTCGAGTGTCAACTGCGCCACGAGGTTCAGAA
TCAGCGCCACGGACGGTGTCGACGAACTGCAATAGAGGGAGCAACACACAAAGCACAACAACTGTTAGCAACACGATGTAGCGGGCCGTGTGAACACTAG
AGAAACGACATACCGAATGAAGGTGTTGAAGTAGACCGTCGTGAAGCAGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGA
ATGACCGAGTCGAAGTCCTTCAGGTTGTACGTACGCTTGATTGCCGAAGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGA
TGGAGTGAAACTGCATTCACGAACACAACCAGACAGCTCGTCAGCAATCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGC
TGGATCTGGCTTCGACCAATTAGACCCGCCAGGTAGACCGGTACGCCGTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGTGGGTCGGGAA
TCAGCTTGAACTGTAGCAAAATAAAGACATCAGTGTTACCATAAGCACGTATGCTGCATGAAGACCAGTGCTTTGCAGCACTAAACACTGTGCTCTCACC
TCGAAGCTCTCCACGGGGCAGGTCAACCAAGAAAACTAAAACGAACAAAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTC
GTACCTGCGAGATGAAGGCACTGGAAAAAAAGGCATAAATCACGGTGCAAACGAAAGCACCTATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAG
GAACGGCGTCTTAATGAACTTGCGACCAAAAAGCTTGCCGCAGAAGAACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAG
AGACCTAGAGGGGTGAACAAGCATATGAATCCCGTTAGCAACTTGTGACAAGGTCGGGATATTTATCACATTCGTACCGTTGAAGATATTCGTGAGGACG
TATTTCATCTGGAAGACGATCAAACCCAGCGTGACAATGGTCCACGTGTATTGCCCTGCAAGCGAGAAATTCACAAGTTAGAATGTCTGCAAACTCAAAA
CGAGATTCCTGCCAACTTACCCATCTGGTACTTGTAGTAACCTACCCAGTCAATAAAACCACATCGTTGACACCAAAATGTTCGTCGGCACAGCGTCAGT
CGTTGAAGCAACCGTACGACAGCACAACGAGCTCAACATCAAATCTACAGTCACGCACCTTTCTTGAGACTCAGCACCGACATGACGAAGAGCATAGCGT
ACATGGTGAACGACACCCACGTGTGGTACCGCAGGTAGTGCACGATGGC