Description :
From Genome Similarity Track
Location :
Scaffold_56:176753- 180823
Sequence
4070 bases(100 bases per row)
TGTGCCACACCTTAACGCCATACGCATGCGCATATCGACGCAAGCACATAGATGCATTTATCCAAGGTTGTTGTCATGCCAAAGTTTAAGCTTCCTGTCG
ACAAGGGTTATTCAGCACGATGTACAAACCGTTTTGTATTTCATTGTAAGTGTATACCCCTAAAGGACCGCATGAGTTCATGTATCATCACATCATTCTG
CCTGCACAATCATTGTTCAAGAACCTAGCATAATTGCGATTATATAGAAGGCAAGTTTTCCTAGTTTTCCACCACAAGCATGTCTATAACAGCCGAAGAA
GTGGCAAATCGATGCAACATATATACACACTGCATAAATCCTCGTGACCAGCTGCATGCTGTAAGTAGAGCACCAGAACAAAATATCCACTACTCTAGAT
GAAAGCGAGGGGTAATCTTGTATTAGTCGAGCAGTGAGCCATTGGAGTCATTTTTATAGGAAATATGACAGAGTTCTTACTGTGTGGGAATATGGATATT
GCATCCATGTAGTACTCTTATTTTCCTTGTATAAACATCTCTAAGTAACTAATCATCTACCACAAACAGCCCTAACCAACATCTCTAGTTATTAAGCCAG
CTTTTCTTCATTGTGGGCGAGACTTGGCATGATACTTTCCTGTCTTCATCAAAGAATACCAGAGCACCTTTCATAGTTTGAGATTGAGAGCACCGCTGCC
TCAGAACATTTGATGCCGGCTTGCGTTTGTCAGCATCTAAACGATAAAATTCCGAAGCAGTATCCACAACTTAATCGTTATTCGACGCACAAATTTCATT
AGCAGTACATAGTAGTGCTACTGGGGTATCTGTAGCGAACCCATCACAAGCGGTTCGAACATCTCGTCGACAACATCCAGTATGCGCGCAATCGCTTAGC
TATCCACTGACGCATATGAAACAGTAGTCGACACATCACTGCTTCACAATTCGTGCACTTATGTCCGATACCTCTCCTTAATCCACCGATCGAAAGGGCA
AATGTGCCAGCCATATCCTTGAGACAGAGCCAAATTTGGATTTCAGTATATCAAATTTGGGGAAATGAGTTAATCAAGTATCAACTACTGATGATCAAGT
TTTCTACATGCGTTCGTCCGGGAATGGAGTCGGTATATCATCAACGAATCATACATGAAAGGATATGATTACACTAGTTATTTCATGATCCAGGTGAATC
TGCACCACAGATGTGTCTTCTCTTGACGATAATGCGCTCGCACTAGCACTACCACAAAAAGATGCGGTAGTTGCTACGGCCACATGTTTCCGTATCGACA
TTTGACGCGATAGTAGCATGTACTTATAATGTTAATCATGCTCATATCACAAAAAATTTACAGTCGTCTTGCTTCGCACATCCACACAGTCGACGAATTA
TATACTATGCAAAGATAGTAGCGCTGTGTAATTTAACTCTCAACATTCGTATTGGACGATGATGGATAGACCTTGCTAAGTAGTCCATTGTCCGGTCTAT
GAAAAGTGCAAATGTAACGCGGGTTATACATAACCAAAAGCGTCAAATTTAAAAAAATGGCTTAAAGGAGCACTCTCTGGCGAAACGCGAAGGTTCTGTA
ATACTACCATTGAGCTAATAAGCCTAAATAAATTTTTATTTGGTTCGTGTACTAACAAAATTAACGGTCGATGGTGTATGAGTGCAAGGATAGCATATGA
CCTACAATCGAGCGAGGTGGTACAAGAAGAATTTGAGGTGCCATAACTGCAGGCCTCAGTCACCAAAAAAAGATATTCCTATCATAACTGATAGCAGTTC
GAGAGCTTCGCTAGCACTTGAAGCAGCAAAAAAATAGAAAAAAGCAAACCTATGACTGATGTTGCTAATAGGCCTGTAAGACTAACAAAAAAAGGCTGAG
TGATGCGTTTTCACGGTCAAGAGTACCGCAGTTTTGTCGATTACCTGTAATGGCAAAGCAAAAACATTGGCGCGTGGGTGTGCTCGTTTAAGGAGTTTTA
AAAACCCAACGCTTTCCATGACAAAGACGGCAAATGTAGCTTATAATTTGGTGTACAGGGGGCCAGCTCAGCCTAACCATCCGAAATCTGTAATATGACT
GATAGTTAATGTTGCGAAGAAGCCATTACGGCATACAAACTTAGTCACGGAAAGTGGTTGATTTTTGCTACTACCAGAACGAAAAAGTTAAATAATGGTT
TTTAGAAACCGAAAATGTTACCAATGTGGATTGCACAGGGATGCAATGAATAAACACCGATTTCTGTAAAAATAAATTACCGACTTATGGTTTTCTGAGG
TATGAGCTTTGTTTAGTGCATTTGTAGCTAGACAGGGCCATATACTTTCGCATATATTAGAAGGAATGCATGCCCTCCAACAAAAGCAATTCGATATTAA
CACTCTTTTTTTGTAGGAAATTGTTTGTTACCCTGAGGCTCAGCTTCCTCCACTCCAAGAATAGTAATCAAGAATATTTGGATGCTGAATAGTCGCCATC
ATTTTCATGTTTACTTCCACAGCGTTATATTAGCTTCAACGTTCTTGTATTTGCATTCTTCTGCCTTTTTGAACTCTGTTCCCATTATTTTGTCTCCTCA
AACAAGCCGGGTACTAATGCATTATTTCTTCTCACCCATTCTTCCTAGAACAAGGGATTTCAGCATTTTCTGGCAATGCAAAATAATAAAATGATTTTGT
TGATGTAAAACGCATTGTAATAGGAAGCTATTTACATTCCCCGCCCTTATTTCCCGCCCTACGTAGACATCGTATCTAAGCCACAAATGCAGTTCTTTAG
CGTCTACATTAAGCCGATCGAAAAAAACACTTTATCTATAACATGCTATTTAGTATCTACTAGTTCAAACCGGGGAAACACGGACTCCAAAACTTCGAAT
GCCGAGCGCACGGCTCGATACGTGCATGTGGAGAAGCTCGAGCAGAACACCGATGGACAGATGGACACTAAAATGCTGTGTCGATGGTTTTTGATCGATC
GTTCTACTGCGTCCGTACGTTGTAAAGTAATATCTACGATGGGCCGTACGAACAACATAAGTTGCATTTTACACACTCTCAAAGACTCTTTTCCGACGTC
GCTTTGTTTGTTTGGACCAATGTATAGCGCGTGAAAATCAAATGGAAACTTTACGGACGTTCAACAAGACGCGTGCAAGTTTACACTAACGAACATGTAC
CTGTGCTTTAAATTAAGCATGATGGACGAAGAAAAGTGGTAGCAATTTCTCCAGGAAATGCCATTAGATGCGTTCAACAGCCACGCGGACGTGTGGGATT
CAAAAGAGATGCCTGTATTGTAGATGGATCTGTGGAACCAATGGACCAGAGTATAGTGCAGCAGCTACACGCTATAATTTCAGATACTTATTCACTTGCT
TGCTTGGCGGCTTACATTAGGTACTCAACCTGTTCCTCGCTTGCGCCTCTCCCCAGTGGACTTTGTTAGTGCTGATATTCGTTACGGGCGAGCGAGAACC
TACAGCGCATGCTCGGCGTCTTTACCCATCGTTTTTGTGGAGGAGGGCAAACTGGCACCCAGGCGAGACTAGCATTTCGAAATAGACGTCCAGCAGAATA
AACATATGATTACAGTCTCGTCAATTGAAGAAAAAACCAATAATTATTGTTATGGTCATGCATATGGACGGATCACGTATGCATACAAGCGGTATATCGC
TTTCAGAACTAGCGGGGGTGGTAGAATCGGTTGAGGGGGGGCATGAAATATGATGGTACGTATGGGTTAAGTAGTACGTGGCGACTATGGCTACTGGCGA
CTCTGGCGACGCGTTTATAATACCAGTAATTTTTGCGTCTTATGTACGATCCTTACGTAGAGCGGAAAAATGAGGGCGGGGAATGTGAATAGCTTCAAAA
AATAGGGAGATAATGCAGATCAAGCTAAGATTACACTCATCAAAACTATCATAGTTAATATATATATTTAGTTAAGTAGTACAAACTTGTAGAAGTACAG
TGGATTAACATGTTATCACGAATTCCTAAACTTACTTTCGTTGAGTGTTTTCACGACCCATCAGAATTTG