Description :
From Genome Similarity Track
Location :
contig_179:17674- 22687
Transcript NameFunction/comments
g13453.t1hypothetical protein
g13454.t1RAW36324.1 hypothetical protein PC110_g7397 [Phytophthora cactorum
g13455.t1ETI54568.1 hypothetical protein F443_02633 [Phytophthora parasitica P1569

Sequence
5013 bases(100 bases per row)
CGGGCGCACAGCAAAGGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAATCCGTCCTATCGTTAAGATGTGATTCGGAGACACGACGAG
ATGTGCTGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCAATCATTGATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCT
CTCACAGGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAACTTTGGCACAAGCCGCTATTTTTCACAACTACATGTACTC
GAGTTGGCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTACGACGTCACAGGTCACACAGATCACGGGAGTATATCGTAT
CGCATGCCTCTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTTGTGTCGGACCCTCAAATGAGTCGCCTTGACGACCCGGAGG
GATAGCCTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAATCAACAAGCTCCAGGTGTGGAGATGAAGACCCACGTCGTC
CTCTGCGCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACTGTGAAGTACATCGACTACTCGTCCTTGAAGAATTTAACGA
GAGCTCCGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAACAGCAACAACAACAACCTATCCCGTTAGTGACGCCTACGCAGCGGCCGGA
CCCACGCGCGACGGAAGCTCCGACACTGCACCGACGCTACCTCCTACGCCGGCACCGACTCCCGCCCCGACTCCGGCACCAACACCGGATCCTGGTCCGT
GGGTGACCGTGTGGATTGACCACGACCAAGTGAAGCCGTTCGCACAACCTGAACCTATCACGATCTCCGAGAAGGCTGGTGTCAAGTTCAAACCGCAGAT
TCACGTCACCAACGGATGCCACCCGTACCCTGCAGTGAACGAAGCTGGTGAGACCGGTGGCGGTCTCAAGACGAAGGGCGCTCCCAGTGCTGGATGCAAG
GGTTCCGGATGGGGCTCCCAGTGTACGGACGTTCCGGTTGGTACCAGGACGTGTGGGCCATCATGTACTCCTGGTACTTCCCCAAAGACTCGCCTTCTAC
GGGTTTAGGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAACCCGGATGTGGAGAATCCCAAGATCCTGGCCGTCACCCCGTCGGCGCAC
AGTGGTTACTCCAAGCAGGTTCCGCCCAATGCCGACTCCGTTGATGGTACGAGTGTCAAGGTCGAGTATAAGAGCAAGTGGCCGATTAACCACGCCCTGG
AGTCGACTTCCCAGGGAGGTGACTTCCAGGACCTCATCATGTGGGACCAGTTGTCTGAGAATGCCCGCCGGGCTTTGAACTCGGTGCCTTGGGGCGATGC
GAACACGCCGATGAACGATGGCAACTTCCAGAACAAGCTAGGCAAGGCTTGGCCCTTTTAAATGTTGGTGGTGAAGGTAGCCAACGCAAATGTAATAACA
CCAGCGTCCGCGTATGGTACTATCTATCTCTTGCGAATCCCCATTATTGAAAGTTGCCCTTATCTCGGTGAGACCGCACAGCTCAAGATCAGTTTCGTCA
CTTCCCGGTGGTTTCGTGGAGATGCCGTGGCCTTGAAGCGACGGCCAAAGCTCAATAGGAGATTGCAAGCACACTGAACCAGCATGGGGTGCTGTTCCAA
TAAGCAGCAGGTGGGCGTCAAGGATGAAGCTGCATCGCAAGGTGTGGCACCAGCTAGTTCTCGCAAGTGTCGAGATGTGCTCTGCGTCCTGTTTTTCGCG
GTGTTCTGGGTGGGCATGATCGCTATCGCCGCCGTTGGGTTCATGCACGGTGAGCCCAAACGACTGCTGTACGGATCAGACTACAACGGCAGCACCTGTG
GCACTGGGGAGCAAGAAGAGTATCCGTTGACGTTTTATCCTCGGATCACGCAGGACTTACTGGAACAAGCGTCAAACCCGTCACTGTCTCCGGAAGACTT
CTCGTTCTACGGAGTCTGCGTGGAGAGCTGTCCGGATGCTGGCTCGTACATTTGCAACTACGAGGCCGAGAACGAGATCCAAAACGATCCGTCACTGACG
ACCGATGAAGAGCGAGGACGAGAACGCAAGTCGAGGGCGACGAGCTTGTTGGTTCTCCCTAGCGAAAAAGAATGTTGGCTGGTTGCTATGTCAAGTGAGC
AAGTGTTTTATCGGTGTCTTCAGCTGACGGAATCCAACTCGACGTCTGTAGAGAAGTGCGTGGTTCCTGGAGATGAACCCGAGTACTACGACGAGGTAAA
TGGCGTACAGGTGCCAAACGACAAGTGCGAGATCAAGCGAGTGATCACAACTTCGGAGGCACTGGGACCGGCGCAGGAGAACCCTCTATACTCGACGCTG
CAGACAATGGGCGCTACCATCGGGCGCGTCATCGGTGACTTGCAGGAAACCTGGCCGGTATTCCTTACCTGCGGAGGAGTGCTGGCCCTTGTTCTAGGCT
TCGCGTTTGTAGTGTTGCTGCGCTTCTGTGCTGGGTGCATCGTGTGGATTATGCTTTGGAGTTTCGTGTTGCTGCTGTTACTCTTCGCCCTGATGCTCAG
TGCGAAGGGTGGAATCATCGGTAGCTCGGAGCTCAGTGCGATCACTGCAGAGCTGGCAACGGCGGCAGCTGCGGCTGGCGTAAACGCAACGGAAATGAAC
GTGACAACGATCGAGCTGCCTCAAACTCTTCGCGCCAGCGAGGACAAGCAAAAGGCGTACGCGGTAGCAGCATACGTTTCGTACGTTCTAGCGGGGGTCG
CTCTTTTACTCGTCTGCTTCTTCCAGAAGAAGATCCGTATCGCGGTTGGCATTGTGAAAGAAGCATCGCGCGCGCTGCAGCACTTGCCTCTGCTAGTGTT
GTTCCCTATTATCCCGTTTATCATGCTCCTCGTGCTCTTCGCGTACGCTGCAATCGTTGGAGCGTACATCTACAGCTCAGGCGAGATGCAGTTGGCTTCA
CTTGCAGGCGAACTGGCCGACCAAGCTGGGCAAAATGTAACAGCGGAGGCAACTACGACGCTGAGCCAGGTGAGCCCTGACCAGACGATGAAGCTCTTGG
TGGCGTATCACTTCTTCGGTTTCCTGTGGACGGCGCAGCTCATCAACGCCATCAGCATGTGCACGATAGCTGGCGCCGTGAGTCGCTACTACTGGAGTCG
CAACAAGACCAGCGAGGAAATGGGGCCCTTCCCTGTGCTCACTTCCTTCAAGAACTGCTTCCGCTACCACTTCGGGTCGCTGGCATTTGGCGCGTTTATC
ATCGCAGTAGTGCAGTTCATTCGTGCTGCACTGCTGTACCTGGATCACCAAACACAAGACGTGCAGAAGTCCAACCTCGTGCTCAAGGTCGTCATGAAGA
TCGTGCAGTGCTTTCTTTGGTGCCTCGAAAAGTGTCTGCGCTTCCTGTCCAAGAACGCCTACATCCTCATCGCCATGAAAGGCCACAGCTTCTGTTCGTC
CGCCAAGGACGCGTTCAAAATCCTGTTGAGCAACATCGCGCAGGTGGGTGCCGTGTCGACGGTAACCTTCTTACTCCTCGGCGCTGGGAAGGTCGCCATC
GCTCTGAGCTGCGCCATCGCCACGTTCGCCTACTTGGAGAAGAACAGCGACGACTACGGCGTCGGTGGCGCTCACGAGCTGTCGTCACCGCTGGCACCGA
TCCTGCTGGCGCTGCTACTCGGCTGGTTCGTAGCGTCCACACTCCTGGGCGTGTACGAAATGGCCATTGACACGATCCTACTCTGCTTCTGCGAAGACAA
AGAGGTGAACAAGACGTCAGGTCAGTACTTCATGAGCGACTCGCTCAAGAAGTTCGTGGCCAGCGTCCCGGTCTCCAAAACCGAGTCCCCAGCTACCGAC
ATCCAGGAGTAACCACTGCGTAGATAGCAACAAAATACACTTGCATAATGTATCGACCAAGTTGAAGTTACGGTCCTTTATTCGAGAGGTGCCCAAATCA
AGTTTTGACCAATAGCTAATTGGGTACCTTGCTGAAAATGGGCACAAATCTCAACATGACGTTTTTGATGCGCGGCCGGCGCGCCGAGCTGCTGGTGGCT
TCGGCCATGACAGCGTATGTGTTCCTGTGCCCCTTCGCTAAGGTTGAAGAGAGCTTCAACCTGCAGGCGACGCACGACTTGTTGGTATTCGGCGCTCGGA
GCGTCGAGAAATTCGACCATTTGGAGTTCCCGGGAGTGGTGCCTCGCACATTTTTGGGCTCTTTGGCGGTCGCCAGCGTCAATGGGCCCATACATTGGGT
GTTTATGATACTCGGTGCCCCAAAACTCTGGATGCAGGTAGCGACGCGCTGGGTGCTGGGCATGGCGACGCTGGGGGCTCTGATGTTCTTCAGTGACGGT
GTGGGGATGCGCTTCGGCCGAGACACGAGTCGCTTCTTGCTGCTTATTTGTGCGTGCCAGTTCCACTTGGTGTTCTACATGAGCCGCACATTGCCAAATG
TGTACGCATTGGTACGTTGGTAGAATGGGAAGAAGAATACGTAGAACCAGGTAGAGTGACATTGTGTGTTTGCTTTTGTAGGTGTTGGTGCTGTTCGGAC
TGGGCTTCTGGCTTCGAGTATGGTGTCTTTTGATAATTTTTGACGATGGCAGTTGGTTGACTCGGTGTTTGGTCTGTTGTTGACGAAATGCAGGACAAGT
GGCAGCGCAGTGTGTTCCTGTTTACCTTTGCGACGGTCGTGTTCCGCGGAGATACCATTGTGCTCTTCGCTCCATTAGTGTTTGAGCATGCTGTTGTCGC
GTCGGGTCTCGTTTTTCAAGATGGTGTGGTGGGGCCTCTCGGCGGGAATTGTGTCGTTGGCGGCGACGGTTCTCGTGGACTCGTACTTCTGGCAGCGCTG
GCTGTGGCCCGAG