Description :
From Genome Similarity Track
Location :
contig_49:176715- 181743
Transcript NameFunction/comments
g10169.t1OWZ18887.1 Phosphatidate cytidylyltransferase [Phytophthora megakarya
g10170.t1POM66520.1 Alpha-N-acetylglucosaminidase (NAGLU) [Phytophthora palmivora var. palmivora

Sequence
5028 bases(100 bases per row)
GTTTCTCTTTCTGTCCTCCTTCTAAGCAGTCAGATGGTTGTGCTAATGCTGAGATGGTCTCAGCCTTGGAGCATCTCTTGGATGGCTCGCAGCACCTCCT
GTTTCTGGTCGAGTGTCAACTGCGCCACGAGGTTCAGAATCAGCGCCACGGACGGTGTCGACGAACTGCAATAGAGGGAGCAACACACAAAGCACAACAA
CTGTTAGCAACACGATGTAGCGGGCCGTGTGAACACTAGAGAAACGACATACCGAATGAAGGTGTTGAAGTAGACCGTCGTGAAGCAGTTTGTGATCAGC
TGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCTTCAGGTTGTACGTACGCTTGATTGCCGAAGCGTAGAAACCTC
CGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATGGAGTGAAACTGCATTCACGAACACAACCAGACAGCTCGTCAGCAATCGCCATACATCGA
TCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAATTAGACCCGCCAGGTAGACCGGTACGCCGTAGGAATGAGGGA
GGAACACGTCACGAGGTGTGCACGTGAGTGGGTCGGGAATCAGCTTGAACTGTAGCAAAATAAAGACATCAGTGTTACCATAAGCACGTATGCTGCATGA
AGACCAGTGCTTTGCAGCACTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGCAGGTCAACCAAGAAAACTAAAACGAACAAAAGACAACACAAT
CAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGCACTGGAAAAAAAGGCATAAATCACGGTGCAAACGAAAGCACC
TATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAGGAACGGCGTCTTAATGAACTTGCGACCAAAAAGCTTGCCGCAGAAGAACGCAAAGCAGTCG
TTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACAAGCATATGAATCCCGTTAGCAACTTGTGACAAGGTCGGGATA
TTTATCACATTCGTACCGTTGAAGATATTCGTGAGGACGTATTTCATCTGGAAGACGATCAAACCCAGCGTGACAATGGTCCACGTGTATTGCCCTGCAA
GCGAGAAATTCACAAGTTAGAATGTCTGCAAACTCAAAACGAGATTCCTGCCAACTTACCCATCTGGTACTTGTAGTAACCTACCCAGTCAATAAAACCA
CATCGTTGACACCAAAATGTTCGTCGGCACAGCGTCAGTCGTTGAAGCAACCGTACGACAGCACAACGAGCTCAACATCAAATCTACAGTCACGCACCTT
TCTTGAGACTCAGCACCGACATGACGAAGAGCATAGCGTACATGGTGAACGACACCCACGTGTGGTACCGCAGGTAGTGCACGATGGCAGGCGGCACGAA
GCGAATCTTGCTGCTCTCGATGAAGGCGCCGAACGAGTCGCCGTAGTTGTAGAACAGCGCCACCACGAACCACATCCACTGCAGCCACAAGAGTCAGCAT
TAGTCTATACCTTCCCTCCTCCTCCCCCTCTCCATTTGCAGCTGCACGCACCTGCACGGAGCGGAACCACGGGATATTCTTTTCGGCCGCCGCCCGGTAG
CGCACGTTCACGAGCTCGCGGAAGAGCAGCGTCTGCAGCAGTACCACGAGCCCCCACGCGTACATGTGGCCGCCGTACAGGATGGCGATGAAGCCGCCGA
TCATGGCGAAGCCCACAACGACGCGCGTCATGAACTTGGTCAGTCTTCCTGCGGGCTTGACCGCGGGTGGCAACGCATTCTGCGCGTGCTTGGGGCTCCC
CTCGGGACTCGAGCGGCGTTTACGCAAGGCCATCGTCTGCTGTGTCTTCTGCTTGCCTACTTGTGCTCTGCGCGCTCGGACAGCGTTTATGCCTTGTCTG
CGTGGGGGAAGTGTACGTCAGCGAGGACAGCACCCTTGTGTGAGGCTAAATGAGCTGCCCAATTCTTTCGTTAAAACCCTCAATGAGTCGGCCATTACGA
CCAATAAGCGTTCAGATGTTATCTTATTGGTTGATAAAGGTGATTATTTGAGTGCGTACGACGCAGAATATGGTGTTTTTCAATTAATCGAGGACATTAC
CTCGCGCTGCTTCGTTACGTCATGACACGCAGCGATTTACTTCAGTTTTATTAATTGTCGTTTAATTACGCGACTAATTACGTGGTTGAAGAGCTCAAAA
CTCAGATTCGATGAAGCGAATCTTGGTGACGCTCCTGCTGCTGCCGCTGCTCGCGGCGGCCTCCATCGACCAGCTGAAGAAGAGCGCGGGGGCGCACGAC
GTCGTGGCGACGACGCGCGGGCTCATCCACCGCCGACTGGGTGCACGCTTCAACGACCAGGTTCTGCTGTCTACGATCACTTACACGTAGGAGATTGCAA
TGGGAAACTAACAATGCATTGATACTAGATAACGCTCCGAGTGCTGCCTTCCGAGGCCGATAATCTGGACGTGTTTGAGCTGGGTAACGACGGCGACAAA
CTCGAGATCGTCGCCAACTCGGCCACCGCCATGGCGTACGGCCTGCAATGGTACTTGAAGACGGCACTGCACACGCAGACAGACTGGGACGACCACAAGC
TGCAGCTGCCCTACGTGCTACCAAAGGTGGACCAGCGCGTGCGGCACAAACGTAGCAGCAAGTTCTCTACTACCAGAACGTGTGCACGGTGAGCTACTCC
TCGTGGACGTGGGGGTGGCAGAAGTGGGAGTACCATATTGACTGGATGGCGCTCAACGGTGCGTATCTTTTATATATATTTCAGATGCAAGATGAGACTT
AGGGCTTAGTACTGACACTCGTGTGTCCACTGCTGCTCAGGTATCAATATGCCGCTTGCGTTCACTGGGCAAGAGAGGTGTGGCAGAACACGTTCCAGAA
ACACTATAACGTTAGCGCTGCTGGTTTGAACAAGTTCTTCGCCGGATCAGCGTTTCTGGCGTGGGGTCGCATGGGCAACCTCCGTGGCAGTTGGGTGGAG
GGCCCACTTCCGCAAGCCTTTATTGATGGCCAGTTCAAGTTGCAGTTGAAGATCCTGACGCGCATGAGGGAATTCGGTATGATTCCTGCCTTGCCAGCCT
TCGCTGGCCATGTGCCAGAAGAGATGAAGTCGCTGTTTCCAAAAGCAAAGTTCACTCGCTCGCCTAACTGGGGAGACTTTTCAGATGAGTTCTGCTGTGT
ATACATGCTGGACCCCGCAGACCCGCTCTACCATGAAATCGGCAAGACTTTCCTTGAGGAGCAGCGTGCTCTCTACGACTACACGTCTTCGCTGTACCAG
TGTGATACCTACAACGAGATGGACCCAGAATTTACTGATCCGGTGCGGCTGCAGGCTGCATCGCGCGCTGTCATCGATAGCATGACGGCTACGGATCCTA
ATGCAGTTTGGCTCATCCAAGGTTGGCTCTTTGTCAACAGTCCAGACTATTGGACCAAGGAACGTGTGAAGACATACCTGGACGGCGTGCCCAACGACAA
AATGATAATTCTGGATCTCTACAGCGAGGTAAGCCCAGTGTGGAACAAGATGGACAACTACTTTGGCAAGAGCTGGATCTATTGCGTGCTGCACAACTTT
GGTGGCAACACTGGGATGCGTGGAGACTTACCGACGCTCGGCACAGCACCCGTGTTGGCCAACCAGGCCAGCAATGGGACGATGGCAGGTGTGGGTCTGA
CCATGGAAGGCATTTTCCAGAACTATGTGGTGTACGATCTCACCTTGCAGATGGCATGGGTGGATGCTCCACTAGACATGGACGAGTGGGTCCCAAGCTT
TGCAGTGCAACGTTATCACTCACAAGACGCGCACACGGAACGGGCTTGGGGCTTCTTGCTGCAGTCGGTATACAATCGTACGCTGGGTTACGGTGGTGTT
ACTAAAAGCTTGGTGTGCTTGATACCACACTGGAAACTCGTTCGTGATGGCTTTATGCCGACTTTAATCACTTACGACCCTATGGACATCGCTCGCGCTT
GGAAGGAGCTACTGTTTGCGGGGACAGAGCTGCATGCTGTCGACACGTACCGCCATGACCTGGTCGATGTCACGCGGCAGTTCCTTAGTGACCATTTCAT
GGCACAGTACCTCCATTTGAAGGATATGTACACAGGAAAGGAGTGCCAGCAGACCAATTGTGTGCTTGGACGGGTCGCATGCTTATCACGATCGAGCGCC
TGGACGAGATTCTAGCGACGAGCGATGACTTCCTGCTCGGCAACTGGATCGCCGACGCACGGGGCCTTGTCGACGAAGGTGATATTGCCACTGTGGACAA
TCTTCAGGATTACTACGAGTACGAAGCTCGGAATCAAGTGACACGCTGGGGCGACAACAACTCCGAATCCATTCATGATTACGCAGGCAAGGAGTGGGCT
GGCCTCGTAAAGAGCTACTACTTGCCTCGCTGGCGCATGTGGCTAGGAGAGGTATGTCAATCATACACCCAAGGACGCAAAATCAATGAGGACGTCTTGA
AGAAAGCTCGCATCGCGTTCGAGCTCAAAGTGGCAACTCAGCCACGAGTCGTACCCAACCATGCCGACGGGCGACACGCTTGCCGTTTCGAAGCGCATTT
TCGACGAGTTTGCCGCTCTAAACACCGTACAATGGCCCTGGGCATCAAAACTAGCGCGAGACGCCTTTCAGACGGCGGTAGAGTGATCCATTGTGTGTCT
AGGTCTGCTCCGAAGCAAAAAGACAAGTTGAAGTTGCTTTGATACACTGTACACTGTATCGAAATGATAGCATTACTGAAGTGGTGCACACCACATTGCG
ATTGGAAACGCGGAGTCATGCCCACCGCATACCCTTAATTGAGACCGAGGACATCATGGAGCAGCCCGTGGACAAGGAGACAGCCAAGAACAAGTTCCGC
TCGTCGCGGCTGTCGTGGAGCAACCAGG