Description :
From Genome Similarity Track
Location :
contig_179:17669- 22681
Transcript NameFunction/comments
g13970.t1hypothetical protein
g13971.t1RAW36324.1 hypothetical protein PC110_g7397 [Phytophthora cactorum
g13972.t1ETI54568.1 hypothetical protein F443_02633 [Phytophthora parasitica P1569

Sequence
5012 bases(100 bases per row)
CACAGCAAAAGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAATCCGTCCTATCGTTAAGATGTGATTCGGAGACACGACGAGATGTGC
TGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCAATCATTGATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCTCTCACA
GGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAACTTCGGCACAAGCCGCTATTTTTCACAACTACATGTACTCGAGTTG
GCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTACGACGTCACAGGTCACACAGATCACGGGAGTATATCGTATCGCATG
CCTCTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTTGTGTCGGACCCTCAAATGAGTCGCCTTGACGACCCGGAGGGATAGC
CTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAATCAACAAGCTCCAGGTGTGGAGATGAAGACCCACGTCGTCCTCTGC
GCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACTGTGAAGTACATCGACTACTCGTCCTTGAAGAATTTAACGAGAGCTC
CGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAACAGCAACAACAACAACCTATCCCGTTAGTGACGCCTACGCAGCGGCCGGACCCACG
CGCGACGGAAGCTCCGACACTGCACCGACGCTACCTCCTACGCCGGCACCGACTCCCGCCCCGACTCCGGCACCAACACCGGATCCTGGTCCGTGGGTGA
CCGTGTGGATTGACCACGACCAAGTTCAGCCGTTCGCACAACCTGAACCTATCACGATCTCCGAGAAGGCTGGTGTCAAGTTCAAACCGCAGATTCACGT
CACCAACGGATGCCACCCGTACCCTGCAGTGAACGAAGCTGGTGAGACCGGTGGTGGTCTTAAGACGAAGGGCGCTCCCAGTGCTGGATGCAAGGGTTCC
GGATGGGGCTCCCAAGTGTACGGACGTTCCGGTTGGTACCAGGACGTGTGGGCCATCATGTACTCCTGGTACTTCCCCAAAGACTCGCCTTCTACGGGTT
TAGGCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAACCCGGATGTGGAGAATCCCAAGATCCTGGCCGTCACCCCGTCGGCGCACAGTGG
TTACTCCAAGCAGGTTCCGCCCAATGCCGACTCCGTTGATGGTACGAGTGTCAAGGTCGAGTATAAGAGCAAGTGGCCGATTAACCACGCCCTGGAGTCG
ACTTCCCAGGGAGGTGACTTCCAGGACCTCATCATGTGGGACCAGTTGTCTGAGAATGCCCGCCGGGCTTTGAACTCGGTGCCTTGGGGCGATGCGAACA
CGCCGATGAACGATGGCAACTTCCAGAACAAGCTAGGCAAGGCTTGGCCCTTTTAAATGTTGGTGGTGAAAGTAGCCAACGCAAATGTAATAACACCAGC
GCCCGCGTATGGTACTATCTATCTCTTGCGAATCCCCATTATTGAAAGTTGCCCTTATCTCGGTGAGACCGCACAGCTCAAGATCAGTTTCGTCACTTCC
CGGTGGTTTCGTGGAGATGCCGTGGCCTTGAAGCGACGGCCAAAGCTCAATAGGAGATTGCAAGCACACTGAACCAGCATGGGGTGCTGTTCCAATAAGC
AGCAGGTGGGCGTCAAGGATGAAGCTGCATCGCAAGGTGTGGCACCAGCTAGTTCTCGCAAGTGTCGAGATGTGCTCTGCGTCCTGTTTTTCGCGGTGTT
CTGGGTGGGCATGATCGCTATCGCCGCCGTTGGGTTCATGCACGGTGAGCCCAAACGACTGCTGTACGGATCAGACTACAACGGCAGCACCTGTGGCACT
GGGGAGCAAGAAGAGTATCCGTTGACGTTTTATCCTCGGATCACGCAGGACTTACTGGAACAAGCGTCAAACCCGTCACTGTCTCCGGAAGACTTCTCGT
TCTACGGAGTCTGTGTGGAGAGCTGTCCGGATGCTGGCTCGTACATTTGCAACTACGAGGCCGAGAACGAGATCCAAAACGATCCGTCACTGACGACCGA
TGAAGAGCGAGGACGAGAACGCAAGTCGAGGGCGACGAGCTTGTTGGTTCTCCCTAGCGAAAAAGAATGTTGGCTGGTTGCTATGTCAAGTGAGCAAGTG
TTTTATCGGTGTCTTCAGCTGACGGAATCCAACTCGACGTCTGTAGAGAAGTGCGTGGTTCCTGGAGATGAACCCGAGTACTACGACGAGGTAAATGGCG
TACAGGTGCCAAACGACAAGTGCGAGATCAAGCGAGTGATCACAACTTCGGAGGCACTGGGACCGGCGCAGGAGAACCCTCTATACTCGACGCTGCAGAC
AATGGGCGCTACCATCGGGCGCGTCATCGGTGACTTGCAGGAAACCTGGCCGGTATTCCTTACCTGCGGTGGAGTGCTGGCCCTTGTTCTAGGCTTCGCG
TTTGTAGTGTTGCTGCGCTTCTGTGCTGGGTGCATCGTGTGGATTATGCTTTGGAGTTTCGTGTTGCTGCTGTTACTCTTCGCCCTGATGCTCAGTGCAA
AGGGTGGAATCATCGGTAGCTCGGAGCTCAGTGCGATCACTGCAGAGCTGGCAACGGCGGCAGCTGCGGCTGGCGTAAACGCAACGGAAATGAACGTGAC
AACGATCGAGCTGCCTCAAACTCTTCGCGCCAGCGAGGACAAGCAAAAGGCGTACGCGGTAGCAGCATACGTTTCGTACGTTCTAGCGGGGGTCGCTCTT
TTACTCGTCTGCTTCTTCCAGAAGAAGATCCGTATCGCGGTTGGCATTGTGAAAGAAGCATCGCGCGCGCTGCAGCACTTGCCTCTGCTAGTGTTGTTCC
CTATTATCCCGTTTATCATGCTCCTCATGCTCTTCGCGTACGCTGCAATTGTTGGAGCGTACATCTACAGCTCAGGCGAGATGCAGTTGGCTTCACTTGC
AGGCGAACTGGCCGACCAAGCTGGGCAAAATGTAACAGCGGAGGCAACTACGACGCTGAGCCAGGTGAGCCCTGACCAGACGATGAAGCTCTTGGTGGCG
TATCACTTCTTCGGTTTCCTGTGGACGGCGCAGCTCATCAACGCCATCAGCATGTGCACGATAGCCGGCGCCGTGAGTCGCTACTACTGGAGTCGCAACA
AGACCAGCGAGGAAATGGGGCCCTTCCCTGTGCTCACTTCCTTCAAGAACTGCTTCCGCTACCACTTCGGGTCGCTGGCATTTGGCGCGTTTATCATCGC
AGTAGTGCAGTTCATTCGTGCTGCACTGCTGTACCTGGATCACCAAACACAAGACGTGCAGAAGTCCAACCTCGTGCTCAAGGTCGTCATGAAGATCGTG
CAGTGCTTTCTTTGGTGTCTCGAAAAGTGTCTGCGCTTCCTGTCCAAGAACGCCTACATCCTCATCGCCATGAAAGGTCACAGCTTCTGTTCGTCCGCCA
AGGACGCGTTCAAAATCCTGTTGAGCAACATCGCGCAGGTGGGTGCCGTGTCGACGGTAACCTTCTTACTCCTCGGCGCTGGGAAGGTCGCCATCGCTCT
GAGCTGTGCCATCGCCACGTTCGCCTACTTGGAGAAGAACAGCGACGACTACGGTGTCGGTGGCGCTCACGAGCTGTCGTCACCGCTGGCACCGATCCTG
CTGGCGCTGCTACTCGGCTGGTTCGTAGCGTCCACACTCCTGGGCGTGTACGAAATGGCCATTGACACGATCCTGCTCTGCTTCTGCGAAGACAAAGAGG
TGAACAAGACGTCAGGTCAGTACTTCATGAGCGACTCGCTCAAGAAGTTCGTGGCCAGCGTCCAGGTCTCCAAAACCGAGTCCCCAGCCACCGACATCCA
GGAGTAACCACTGCGTAGATAGCAACAAAATACACTTGCATAATGTATCGACCAAGTTGAAGTTACGGTCCTTTATTCGAGAGGTGCCCAAATCAAGTTT
TGACCAATAGCTAATTGGGTACCTTGTTGAAAATGGGCACAAATCCCAACATGGCGTTTTTGATGCGCGGCCGGCGTGCCGAGCTGCTGGTGGCTTCGGC
CATGACAGCGTATGTGTTCCTGTGCCCCTTCGCTAAGGTTGAGGAGAGCTTCAACCTGCAGGCGACGCACGACTTGTTGGTATTCGGCGCTCGGAGCGTC
GAGAAATTCGACCATTTGGAGTTCCCGGGAGTGGTGCCTCGCACATTTTTGGGCTCTTTGGCGGTCGCCAGCGTCAATGGGCCCATACATTGGGTGTTTA
TGATACTCGGTGCCCCAAAACTCTGGATGCAGGTAGCGACGCGCTGGGTGCTGGGCATGGCGACGCTGGGGGCTCTGGTGTTCTTCAGTGACGGTGTGGG
GATGCGCTTCGGCCGAGACACGAGTCGCTTCTTGCTGCTTATTTGTGCGTGCCAGTTCCACTTGGTGTTCTACATGAGCCGCACATTGCCAAATGTGTAC
GCATTGGTACGTTGGTAGAATGGGAAGAAGAATACGTAGAACCAGGTAGAGTGACATTGTGTGTTTGCTTTTGTAGGTGTTGGTGCTGTTCGGACTGGGC
TTCTGGCTTCGAGTATGGTGTCTTTTGATAATTTTTGACGATGGCAGTTGGTTGACTCGGTGTTTGGTCTGTTGTTGACGAAATGCAGGACAAGTGGCAG
CGCAGTGTGTTCCTGTTTACCTTTGCGACGGTCGTGTTCCGCGGAGATACCATTGTGCTCTTCGCTCCATTAGTGTTGAGCATGCTGTTGTCGCGTCGGG
TCTCGTTTTTCAAGATGGTGTGGTGGGGCCTCTCGGCGGGAATTGTGTCATTGGCGGCGACGGTTCTCGTGGACTCGTACTTCTGGCAGCGCTGGCTGTG
GCCCGAGGGCGA