Description :
From Genome Similarity Track
Location :
Scaffold_687:17669- 22659
Transcript NameFunction/comments
Phyta_totarag10169hypothetical protein

Sequence
4990 bases(100 bases per row)
ATCGCGCTAAACGCTCCACATTCTCGCTTGGCTTTGGCAGATCCGTCGAAACTCATCACgtggagctcttcctccgGTGTGATCGTCGGAATTGGGATGA
CGGCAATTCGCGACGGACGCTTGCGCGGTGCGATCTCTTCTAGGACGGTATCCACGAAAGCTCTGGGTGTGATGCTCGCGGCTAACGCCCCGAGTatctc
ttcttctccctTCGTGGAGCGATGAATCTCCAGCGTCCAGGGTGAGAGAATGGCTGCCCATTGCGACAGTCGACCTTGTAACTCTTTGGATCGGAACAAC
CACGCCAATGTCGTGTGACGAGTCAAGACGCGTATCGATTACCCAGCCAGCATCGTGAAGCAGTTGTTGATGATGCGccgcaaggccaagatcaCCTTCT
CGACGATATCGTAGTTCAATTCGTTAGGCTTCAATGTGCGACTGGTGAATTTCACCGGCATGTACACGCCGTCATGAGCTTGGGTGAGGACTGCCGAGAT
TTCCCAGTCGCTGGCGTACACGATTACGACGGGTTCTCTGGATAAGTCGTAGTGCTTCAACATCGGGGTCTCGGcgagcttggtcttgaagaCCTCGAAT
GCACGGGAGGCATGTCTCCACTTCTCCTGTTCACGGACTTCTAGTTTCGCGACgtagtcgtcgaagtcgaactCTGTGAGCGAGTACATCGTGGTCGCGT
AGATCGCGACGTCAGCGATGAACCGGTGGTAGTAGTTGAGGCTGCCTAAGAAAGATTGCAAGCCCTTGAGTGTACGCGGGAATTCCAAGCTCGTGAGCGA
TTCCAGATTCGTCGGCTTCGCTTCCAACACGTGATCCGACACCTTGTGACCCAGGTAGCTGACCTGAGACATTCCTCACGTGCACTTCTCCACACTGATG
GACAAGTGTCATTGTTCGCAGACGTCCAGCAGGCGTTCTACCTTCTCGCACAAGTCGTCCCATGACGTGCCACTGATCAAGATAGCATCGATGTACGATC
GACGGCCTAGAACGGAATGGATCCCCGGAACTTCCGGCTTTCCTCCGTCGAAAACGTCTCGTGTACCCCGATCTGGGGTCAAGCTCCCGAAACCATAGAG
CGCGTTGTCGATCAGTCGCTGGCATATCTGCGGCTCGTTACACAGTCCGAACGGCATTCGAGCAGCCCGAACGGGGTCATGAACGCCGAGATTAGTCGGG
CCCGATCTGTCATGGGGACTACATAGAACCCACTGACCATGTCGAGGGAGCAGTACCACAGGTACTTATCCAATTTTTCCAGCAAATCGTTGACGAGTGG
CATCGGATATACTATCAGCTGCGTCAGCCCGTTTACCAGTCTGTAGCCGATGCAGAGCCGAATATCGACcccgttcttcttcacaatCACGACGATGGGT
GATGCCCACGGAGAAGTCGACAGGCGGATCATGCCCGCGctgagcagctccttgagcatgTTAGAgatcttctccttgaacagaGGTGGGAGCTTACGGA
CGCGTTGCGCTATGGGCTTATCGTCGCCGACATCGATGTCACTGACGACCCCCATGGCCGTGGGAGGTAATGCATTGCCTTTCCAGATTAGCCATTTACA
CCGCTTCCAGATGATCTGGCGCAACAGATCTTCTTCCTTCGCAACCACCTCCGATGTGACCCCGGTTGGTTTACCCACTTGGAGATCTTTGATCTTCACT
TCTGCGGTCCGATGGAGTTCTGGCAGAACGGCCATCTCCCCCTCCAATTCTTCTGCGAAGAGGTCCGACCCTTCGTGGCAAagcacagcgtcgtcagcat
CAACGATCTTGTCTGGTCCATCCTCCGCGGTATCCACCGGCACCTGATTCAGAGGATGCGTTCCTTCAACTTTCTCCAGTTGTTCCACGGCGTCGCACTT
CTGCGGCTCTCGTGCCTACTCTTCGCATTCAGACGTACTCGTCGGTTTTGCCGCTGTCACTCGCGCAGCCACTGCTGGGGGCGACTTCCGCTGGCGTTCT
ACTGGGTCTTCCGTCTTACTGTCTCCTCGGCGCATGATTCCTCTGGGGAGTTCATATGTCGGGCGCTCGGTCAACGGTCCGTCGGGTTCGACGGGTGTCC
AGTCTTCGGCCGCATCGTAGGTGGAACCGTACGCGAGGTTCTGCCACTCTTGATAACGTCACGACTCCACTTGCACGAAACCGAAGGCGCGCGGGATGAC
GTCGAGTGTTATTGGCTTGTCACCGATATTGGTCGCCCGCAGGTACATTCGTCGCCCGATTTTGCTCTTCACGAAGGTGCTTACCCATGCCTTCCCTCGT
GTGATCCACAATCGCGGAGCATTCCGGTCTGGTCGTAGGTGAACGTCGTGCGTTCGCCCCgggtcgatcttctcgagcgACGTCAGGGTGANNNNNNNNN
NNNNNNNNtatcgagcagcaacgtaGCACGACGGTTGTTCAACTTCCCGTAGATCTTGGCCTGTCGATAGCATTTGTCCGGCGCGTAGTACTTCCAGTAT
CCGCGTCGTTCTCCAGGCTGCAGGTCGATCACATCCAGCGGCGGTTCTTGCGCATACTTGTCCGGGAGTCGGATATCCAAGACTCGGGGAACACGTCCTC
GCGAGGCACGTTGCAGGTTGGATTCATATGTATTATCGATCGGGGTATTCCAGTCTTCACTAACCGCCTCTTGCGACTTCTTGGTCACATATGCATAGAC
GGAAACAGGTCGCTCGTCTCGTTCTGGTTTCCAAGCTAGTGAACGATCTAGTTTAACATCTTTTCAGCAACCAGTGGCAGCATTCCAGCAGGCTTCTGCG
GGTCGTACCACTCGCGAAGCTGGTTGGAGAATTCCTTCATGGGACATTCCGCGGCTTCGTGCACATCTCCACAAGATCGACACGCACATAGGCATCGGTC
GGTCGGGTGATGGTCACCGCACTTCCGGCAGGTCAATATGCTCCAGCAGTCTTCGTCGGAGTGACGATACGACTTGCAGTGGCGGCATCGCGACTTGTCT
CGCCCCAAGTCGTCCGCGTCAGCGTTACGGTGAgcgttcttgtccgacgGCGCTTGGCCCGTCACGAACAGTTTAGCCTGATCTTGATCGTACACCTGAT
CGCCACGCCCCGAGTCGTATCCGTCTGACGCAACTTGGACCGCGTGAACCGCGCGTGTCGGCGGCGTCGGTGTCGACGCTTTCTGACGGAACTTGCTGGA
TCCAAACAAGGTCTTCTTTTGGTGAGCGAGTCCACGCTGCCGAGCGCGCAGCTTTTTCTCTAATATGACGATATCCGACACTTCCATCAAGGTAAGTCGA
GAGGCcagttcttgttcttgtgaACCGAGGGTGTTGATGAATAACTCCACGTGCTCCCGTTTCTCCTCCTTTGTGCTATCAGCGCAGTGGATCATGGCCC
GCATTTCCGCGACGTTGAGTCGACACAGATACTTCAACGGAGTCTCATCGGGATGTTTGGTGGCATGGTAATACCTACTCGCCATAGACACACCTTTGCC
GCAGTACTGGATGCGGAATTGCTCCGTCAGATCTGTCCAAGACTTCGTGACGTCTCTACCCAGCTGCAGGTACCATTGGCGCGCGGGTCCGGTCATCCTG
TCCCCGAACAAGGCGCACACTTCGTCACCGGTCACCGTCACGGCGCGACGCGGACTTCACGCGATTGAGCCAGGTCCGGGCCTTCTCTTCACTAGAGTCT
CGACCGTGGAACTCCTTCAACTCAGAGAACGCGGAGAGGCGTACGTGGGTGACAGCGACCCCAGCGGTGCCAgccgtcgtggccaagatAGTGGCTGTAT
TCCCTGGCGTACCGGTTTCCAAGCCGAACAGATCGTCCGGGTCCTCATCTCGGTtgcgtcgacgacgaggagatcgcGACGTGGAGTTTGAACTCACCAA
CCCCatggccacgtcggcgtctGCCGGCTTGGGCGTCACCGTCGGTTCTGGCTGCCTCGGTGTGGGCAGCCtgcatcatcgtcgactGCATCAGTCGGAC
GATggcgtcttccagcgcctGAGGAATGGCTTCCTCCTTGGCAGCTGGTGCCTCCACACGGGGTAGTGCTGCGGTGAACTGCATGACGGGAGTGGTCTGC
CTTTCGGCATAGACATCCGCTTGAGCGACTCGACGGTGCTGTCAGCGTCCACGCTCGACGGGTATAAAGGAAGCCGTGGCGTCACTGGTGTCGGGTCCGT
CTTGGCACGAAGTGGAGCGGCCTCGCTTCCGACCGTCCCGACCAGAACGGTCAGGGGATCGAGGATAGCCATGATCGTACGTTTCCAAGACGCGAAGCCC
CAGTCATACACTTTCTCCATCTCGAAAGCTCCCAGCTCGAAGCCTGACTCTCGGAGCATGCCGAAGAGCGCGTGCACTGCCAGCTGTACGTTGGTGAGGC
TGACGACACCAGGAGTTCGGAAGGGTCCGGTGAGCTTGCCGATCAGCTTCGGCTTGAGAAAGCTCAGAATCGGATCGCGTTCCAACTGCTGAAACAACTC
TGTACAGCTCAAGCCGTAATTAAGCTCTTCCGCGGTGTACTGCCGCCCCGCGTCTTTGCCTCCCGACTTGCGTGGCGACTGCTCGTCTGTCGAGCCCGGT
gggcgcagcttcttcttcttcctcgccgACTTAGATCCCATGCGCTTCGCGGGGGCCTTGACGGCGGGTGGTTGTTGGTCTTCAGTCTTAACAGACGTCC
AACCGGGGGGGACTTCGACGCAAGTCGAAGTCCGTGGTGGTTCACGGGGGAACAACATCGGGAACGGCGAACTGTTCTTCGAAAGCCTCCTGTTCATCGC
TGGCCCCATGGTCTATCGTGAAGGTTCCCTCGGAGTTCCACAGCGCAGCTGGTCTCTTTGAGCTCACTTGCCGTCGACGACCTTTCAATCGACGACGCTC
CCGCTTCCGGTTCTTGCTTCGACGTTACCCCATCTTCCGGAGTAGTACGCTCGGGTCGCGGCACCATTGTGGAGGAGTGCCCTCGCAAAA