Description :
From Genome Similarity Track
Location :
Scaffold_38:176633- 180114
Transcript NameFunction/comments
Hyaar_Emoy2805377hypothetical protein

Sequence
3481 bases(100 bases per row)
ATATGAAGGGTGTTTTACCAACGGTCCATCTACTCCAGGCTATGCTTCATCCTCTTCTTCCGTGGTTGTTTCAAACGCGAGTGTCTGCCACTCCTGATAT
CGCCGTGATCCCACGGACACATACCTGGGTGATCGTGGTATCGTATCCGCCAGCCCCCGTTGCCCGAAGGGGTGTCCCTTGTTGGATGATCACCTCTTAT
TCAGTTAGATTGGTCGAGCGAAGGTAAGTCAACCTTCCAAATCCATTCAAAGCCACAGGTACCCAGCGTGAGTGACGTGTTAACCACAATTTTGACTGAA
GTGGTCCCCGACCAACGTTGATTTCTACAGAGTTACCCACCGCAATCGCCAGGTACTTCTCATCCGCGGCAATCCGTTTTATCTTCGCCCCATACGGTGG
TCTTTTACCTTCCAGTTGAATTCTGACCTCGTCCGGCAAGAAAACTGTCCCGTCTGCAAGGTCAAGGCGTATCCCGGTCGGTACAATAAAATCCATTCCT
AGAATTGCTTCTTGTCTCACTTGGTCACGAACCCATACATCAAAGTAATCGACTAGTGACCCGTTCAGCGTGATCTTCACCTTCGTGCGGCCTTCGTCCA
TGTATGATTTCTCTCCAATACCCACATATTCTTGCTTCTGACTCTCATATATGATACAGCCAACCTTACGAGCAAAGGTGGTGTCGATGATCGAGACTTC
GGCCCCCGAGTCAAACAGTAGGGTGGATTTATCATTGTTGATTGTTTCCCCTGACTTGGCTTGCCTGAACCACTTTTTTGGAGTATGATACTTCCAGTAA
CCACGTGATTCGCCAGGAGGCAACTTGAGTTCCATCTTGGTAGGTGGTCGTGCATTTTCATCCGGTCGTCTCAGACTTGCAATTGAAGGCAAACAACTAA
AATTCAAATCATATGTACTGAACGTCCGGCCGGTCAGACCATCAACACTGTTATCAACCCCTTCTCTTTCAATGAATGCATATATACACAGCCTAGAAAG
CTCGGCTCGTACCAGGTCCAACCTGGTGATCGTTCTAGTTTAACATCTTCTCAGCGTTGGGGGGAAGCATTCCAGCATGTTTGGTTGGCACGTACCACTT
GCGGAGCATGTTATAAAACTTTTGCATCGGGCATTTTCCTCCTTCGTGTACTTCTCGACACGCCGCGCACCCGTAGAAACACTTGTCAGAGGGGTGACCT
CGGCGTCCGAACTTCTGGCACGTCAACCGTTTCTAGCATGTACGATCATCATGTCTTCGACCCACAATGAGTGCACGACTTGTGTACTACTGTACGATCC
TGATTCACGTTCACAAGCACCCAATCTTGGCTTGGTCAGACGTTCACTAGTTCGATCCGTCGTTTGATCGGCTGCCGTAGCGCTGTAAACACGTAGTGGT
TGTTCTTCTGAATCTGAACCGCTTATATCTGATCCCGAAGAACTGCCATCGCCCCCCACGTGAATTGCACGCACGGCTCGGGCCGGTTTCGATGGACTTA
GGGTGTATTGTGAGGCTGGTCGTTGGCGGAACTTGCTTATATTGGTCGGGATGTCACCTTTACGGTTCTACATACGCTCTTACGTACGCAGCGTTTCCTC
CAGTATATTCACGTCATCTAATCGCAGCAGCGTTAGTTGTTTCGCGAGGTCTAGATCGTCCAGTGTCTCTATGTAATGTTCCACATGGTCACGGCGATCG
GCTATATTTCCATCTTTCATATGAATTTTTGCTCGCATTCCAGCAACGTTCAGTCGATAGAGATATTCTAACGGAGTCTCATCGGCACGCTTGCAGGCGT
GGTAATACTGTCGACCAGCTGAGATGCCGCGTCCACAGTATTATAAAAGAAAGTTCTCGAGTACGTCATTCCACTTATTGCGTGTCGATCAGCTCAATTA
GGAATACCAATTTCCAGGTGGGCCTGTTAGCAGACCCCCAAACACCAGACACTTCTTCGAAACAGTACTTGGTCACGCAGGAGAGCTGACCCGAACTTGC
GTTACCATCCTCTGATGCGGTGAACATCGTGATCGCGGCCCGAAAATTGTTTAACTCGGCAATCGCAGACATGCGAATTCGTTGCGCGGCGAAACTCCTC
CCAGTAATGGCCTCAGTAGTAGCCAACTGGGGTCGTCGTAGAACGTCTATACCGATATCATCAGGTATGCGTTGCCGCGACTGTGGTGCGGGCCAGCTGA
TTACATGTCGGTGTCTGGCATAAACACACCAAACACATTGTGGTGGTGGGGACGACCGATTTGCGCCGTACGGGGTAGTCGACGGTGTTGGCCGTGTAAT
GACTTCTCCATGGATTTTGAAAAGTAGATTTGCATCTGGTCGGATTCATCCATAGCGATATTTGCGTGGAGTTGAACCCATCGCCATCGTGGTCGGAGCG
GTATGCTCGTGGTGGTCACGCAAAAGTGCTGCTCCAGATGGTCCCTACGACATTCTTTTGATCTCCATGTCATCGTTTTCCTCCGCATCCGACTCAGCAG
AGGCATAGTGCGACAACACAGCCGGAGAATATTCTTCCTCTCTGACCTTAACGGTGGTCGTGAGTTAGCGATCGGTCGAGTCATAATTACCGGTAATTGG
GACCAGCGTTTTAATCAGTGATCGACCGGCAGTGGCCACCTCATCCAGGTTGCAGATAAGCAAAATCTGTGTATCGAACGCCCCCGGTACAAAGCCTACG
CCTTGTAGCAACTTAATGAGCGTTGTACCACTTCCATCTTGTTTGTCGCGGCTCGTGATGCCATCGCAGGTCCTCGGATCGGTCCGATCAGCTCTGGTCT
CAAAATCGTAAGCATCGGATCTGTGAACAGTGAGTCTTGAAGATGGTTCCAGTACAAACTCCACTGTAGCTGATCAATATTTCATCCGTCCATCTTCACC
TCTTTTGCTGCACTCGTTTCCTGTTCGTCGCCTTCAGATTCAGGCGCTCGTAACTTTTGAGCCGCAGCCTTTGATTTTTTTCTTTGTACTTGTTTTTGTT
TTTAGACGAAACATGTCCTGCTTTGGCTGGACGTGTTCCGTCTAGCGGGTCGTACTTTGCAGTACGATCCGCGGTAGTACCCGAAGGGACCTCAGGAGGG
AATAGGGTTTTTTCTTCGTGATCACCTGAGGGATCTTCCTATCTAATTTTCAGCTCACCCGAGCCCCTCCCCGAACTCTGACGAACCGAGGATCCTAGAT
GATCACGTGTCTACGACGATCCCTTCTTCGCCGACTCTTCCATCCCCGGTACAACATTGACCTTGACATCTTCGCTTTGGGGTTCAAGATAAATTCCCGA
GTCACCAGAAGATCCGGACACGCGAATCATTGTGGTGGAGTCGAATTAGCTCATTCTCTGAGGCGATCTCGACTCTTCACTGGCGCCCAGACGATCTACT
AACGGAGGGGTACTCCGATTCCGTGATGTTTGCCTTCCTCACCTTGTTTACCCGTCGGTAGGGCGGATTGCACTCTACCAG