Description :
From Genome Similarity Track
Location :
contig_49:176630- 179581
Transcript NameFunction/comments
g8279.t1hypothetical protein PHYSODRAFT_557610
g8280.t1hypothetical protein

Sequence
2951 bases(100 bases per row)
AGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCTTCAGGTTGTACGTACGCTTGATTGCCGA
AGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATGGAGTGAAACTGCATTCACGAACACAACCAGACAGCTCGTCAGCAA
TCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAATTAGACCCGCCAGGTAGACCGGTACGCC
GTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGAGGGTCGGGAATCAGCTTGAACTGTAGCAAAATAAAGACATCAGTGTTACCATAAGCA
CGTATGCTGCATGAAGACCAGTGCTTTGCAGCACTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGCAGGTCAACCAAGAAAACTAAAACGAACA
AAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGCACTGGAAAAAAAGGCATAAATCACGGTG
CAAACGAAAGCACCTATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAAGAACGGCGTCTTAATGAACTTGCGACCAAAAAGCTTGCCGCAGAAGA
ACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACAAGCATATGAATCCCGTTAGCAACTTGTG
ACAAGGTCAGGATATTTATCATTCGTACCGTTGAAGATATTCGTGAGGACGTATTTCATCTGGAAGACGATCAAACCCAGCGTGACAATGGTCCACGTGT
ATTGCCCTGCAAGCGAGAAATTCACAAGTTAGAATGTCTGCAAACTCAAAACGAGATTCCTGCCAACTTACCCATCTGGTACTTGTAGTAACCTACCCAG
TCAATAAAACCACATCGTTGACACCAAAATGTTCGTCGGCACAGCGTCAGTCGTTGAAGCAACCGTACGACAGCACAACGAGCTCAACATCAAATCTACA
GTCACGCACCTTTCTTGAGACTCAGCACCGACATGACGAAGAGCATAGCGTACATGGTGAACGACACCCACGTGTGGTACCGCAGGTAGTGCACGATGGC
AGGCGGCACGAAGCGAATCTTGCTGCTCTCGATGAAGGCGCCGAACGAGTCGCCGTAGTTGTAGAACAGCGCCACCACGAACCACATCCACTGCAACCAC
AAGAGTCAGCATTAGTCTATACCTTCCCTCCTCCTCCCCCTCTCCATTTGCAGCTGCACGCACCTGCACGGAGCGGAACCACGGGATATTCTTTTCGGCC
GCCGCCCGGTAGCGCACGTTCACGAGCTCGCGGAAGAGCAGCGTCTGCAGCAGTACCACGAGCCCCCACGCGTACATGTGGCCGCCGTACAGGATGGCGA
TGAAGCCGCCGATCATGGCGAAGCCCACAACGACGCGCGTCATGAACTTGGTCAGTCTTCCTGCGGGCTTGACCGCGGGTGGCGACGCATTCTGCGCGTG
CTTGGGGCTCCCCTCAGGACTCGAGCGGCGTTTACGCAAGGCCATCGTCTGCTGTGTCTTCTGCTTGCCTACTTGTGCTCTGCGCGCTCGGACAGCGTTT
ATGCCTTGTCTGCGTGGGGGAAGTGTACGTCAGCGAGGACAGCACCCTTGTTTGAGGCTAAATGAGCTGCCCAATTCTTTCGTTAAAACCCTCAATGAGT
CGGCCATTACGACCAATAAGCGTTCAGATGTTATCTTATTGGTTGATAAAGGTGATTATTTGAGTGCGTACGACGCAGAATATGGTGTTTTTCAATTAAT
CGAGGACATTACCTCGCGCTGCTTCGTTACGTCATGACACGCAGCGATTTACTTCAGTTTTATTAATTGTCGTTTAATTACGCAACTAATTACGTGGTTG
AAGAGCTCAAAACTCAGATTCGATGAAGCGAATCTTGGTGACGCTCCTGCTGCTGCCGCTGCTCGCGGCGGCCTCCATCGACCAGCTGAAGAAGAGCGCG
GGGGCGCACGACGTCGTGGCGACGACGCGCGGGCTCATCCACCGCCGACTGGGTGCACGCTTCAACGACCAGGTTCTGCTGTCTACGATCACTTACACGT
AGGAGATCGCAATGGGAAACTAACAATGCATTGATACTAGATAACGCTCCGAGTGCTGCCTTCCGAGGCCGATAATCTGGACGTGTTTGAGCTGGGTAAC
GACGGCGACAAACTCGAGATCGCCGCCAACTCGGCCACCGCCATGGCGTACGGCCTGCAATGGTACTTGAAGACGGCACTGCACACGCAGACAGACTGGG
ACGACCACAAGCTGCAGCTGCCCTACGTGCTACCAAAGGTGGACCAGCGCGTGCGGCACAAACGTAGCAGCAAGTTCTCTACTACCAGAACGTGTGCACG
GTGAGCTACTCCTCGTGGACGTGGGGGTGGCAGAAGTGGGAGTACCATATTGACTGGATGGCGCTCAACGGTGCGTATCTTTTATATATATTTCAGATGC
AAGATGAGACTTAGGGCTTAGTACTGACACTCGTGTGTCCACTGCTGCTCAGGTATCAATATGCCGCTTGCGTTCACTGGGCAAGAGAGGTGTGGCAGAA
CACGTTCCAGAAACACTATAACGTTAGCGCTGCTGGTTTGAACAAGTTCTTCGCCGGATCAGCGTTTCTGGCGTGGGGTCGCATGGGCAACCTCCGTGGC
AGTTGGGTGGAGGGCCCACTTCCGCAAGCCTTTATTGATGGCCAGTTCAAGTTGCAGTTGAAGATCCTGACGCGCATGAGGGAATTCGGTATGATTCCTG
CCTTGCCAGCCTTCGCTGGCCATGTGCCAGAAGAGATGAAGTCGCTGTTTC