Description :
From Genome Similarity Track
Location :
contig_56:1766- 6847
Transcript NameFunction/comments
g8669.t1hypothetical protein
g8670.t1hypothetical protein PHYSODRAFT_343940

Sequence
5081 bases(100 bases per row)
CGACCCCGGTGCAACCACGCACTCTTTTCACTGGCAGTCGCATGCTTCGCGACCTCAAAGAAAATTAGCGCTGGTGCGCGTGCCCGTGTCGTAAAAACAG
TCCCTTCTTCTTTTGCAATCGTAAGGAGCCGCTGCAGTGGGTCATCGCATGACCCTAGTGGGCAGAAAGCTCCTTCTGGCAACTCGAGTTTTTGCAATTC
ACGCCTCAATGCGTTCTTACGTTCATGCGGAGGACAGAACCTTAGTCTTTCTGTCATCGTACACAGCTCTTCGATGAACTGAATCTGCGTGGTGAAGATC
CGACGCTCTTCCCCGTCATCACGATGAGAATCTTCTGGAAGAGTATTGTTGGCAGTAGGAAATCTGGAGGAATTGAACAGCCATTAACAGCATCGCAGAT
TGCACCAAGCGGAATAGTGGCCTTCGTATCTGTGTGAACGAGGATTAACAGGCGATCGAACAGACACTTGATGATGGCCGTTTGCTCTGTCGAAGCTGGT
AGATCCTTGTCCGTTTCAAAAGACCAATCTCCATGAGAAATCTGCATCTCTACGTTGATCATTAGCAACTTGCACATGCTCATCTTCCGGTACAGGAACT
CGGGCACATACAACTCTGACTGGCCGAAACCCCATCCACAGCTGTCGTCAATTGCTGCGCGGGTTAACCAGTAGATAGCAGTTGCTAAGCGGATATGGAG
CTGAGTCGCGTAGCAAATCACTCGAAAAAGAAGTGCCGCTTTGACACTGTTGCTTGTCCAGTCCACCGTGAGCCACATGTGAAAAATTTGCGGTAAAAAA
AACTCGAAATCCGACAAATTTGATGCCGACAATTCCAGGAGCTTGTTCACAGCAAATGCATACGCTTCGTCGCAGCCATGGCGATGCAAGTGCAGCACTT
GAATGACGTCAGATATACCAAACGCATCGTCGCCAAATATGGAGAACAATGCCTCCACCTCTTCTTCGTCGGCTTTCGACAGAGCAGGCTTCTTGGCACC
CTCAGCCTCCGTCTGGGCAATGCTTAGCCGCTGCAGTAACATCCCGAGCCACAACACAAAGCGCTGAACTCGATAACATCCCACACAGAGGCGCACTGCG
TGGTTCATGTGGAAATGCCTCAGCATCGCAAAACGGGAGCTGTGGTCCGAGCACACGGACCCGCCGCAATTCCGGCAGTGGTGCTGTCTCTTTCCCGTAC
TGTCAAAGCGTACATGGCAGCCTGGGTGGCAGCACGTCACATCATTCTTAAACTTGGGCGGACTGCACTTCTTCTCAGCAAACGCGAGACCTCCAGGGGT
AATCTCCACGATCCCAGGGCTGACCGAGGCATGCGCATTCCACTTTTCCACAGCAGCCTCCGTTCCTCTCAGCGCCGTCTCGATATACTCGATCCACTGC
CGCTTGTCCTCCTCCGAGTCCGCGTCCACATTAAACACGACCCCAGAAGTGAACGAGAGCTTAAACGAGTGGCGGTACGTGTGCCACAGCCCCTTGCCGT
CCCACGCCTCCACCTTCTGCACCTCGGCACTGAAAAGCGCCGCGATCATCGCCGACGCCACATCACGCGACGCAAAGTGCGAGAAGTTGACACCCACGCA
GCGACAGTAGAAGCGCTTCATGCGGTGGTATGTCACGCCCTCGTCACGCATGCACAGGTACCCCTTGATGCCCAGTCCGTCTCGCTCGACGCCCAGAGGG
CCCAGCAGCTCCATGGAGGACGACGCGGCGTTTTCGGACATAGTGGAGCTGCGTCGCTCGTCATCTGCCCCTTGTGTGGACGGTGGAGCGGAGACGGCGG
CCGCTGGAGACCGCAGATCGTCGTTGGTGGCATCGTCTGCACTGCGCGATCCTTCGCCGTCTTCCGAGTGATTCACAGGTGTCCGGGGCTCCTCCGACTC
CTCGGTCATGTTGTCATACACAAGCAGGTAGGTACAACGCTAGTAATTGAGCTGTGGATGCGTCCGCTATTGTGCCTATGCAGCGAGCAGGACACGTCGA
CAGGTGAAGTGCCGGCGCGATTCAGCGGCAAACGTGAACGCGACGTCGGACCTCGACTGGACGTTTGCGTGCGGTTTATGTAACCAATGTGTGGTGCACA
TGGAATATGGTGTGGTAGACATAGCTTCTTTAATAGAATATTCCGGTCGATTTTCGAACGCTATAATATCAGAACTGAGGGGTTGATTGTGTGTAATTTG
TGTATATCTGATCCGATTTGCCAGGGGATGGCACATCCTGAACATAAACACCGACAGCCGTCCATCTGTATGCGATACTAGAACGGGGCCAGATACACGG
AGCACGCCGCCGTGGGAGGTTGACGGTCGCAGGAAGAAAGGAAGGAAGGAAGGTCGGCAGCGCCAGAGCACAATCCGCTTCTTCAAGACCGAGCAGCCAT
GACGACGGCTCGGCAGTCGCGGAAGAAGGGCGTGCGTCGCCTGAAGCAGATGCAGGGACTACTGCGGCTGTCGGCGTCTGGACGAGTCCGCACGCCGCCA
CCAGTCGGGCAAGGCCAAGCCGCAGCGCGTGACAGTAGCGCTCCAGCCGCAGCTGCTGGAGCTCGCATACTCGGCGCTGGCGGACCAGGACATGCTGCAT
CCGTTGGGGCGCATTGACCTGCGCGACGCCAAGCTGGAGCAGGTCCCCGACGGATTCATCATCCACGAGGCGGGCACGGGGCTTCGCAAGGTTTGTGGAG
GTAGAATTAGGTAGAGTGAAGTAGGCTCTGAAACCACTTTTTTGTTGTGGTGCTCTGCAGAAGGTCAAGCTGCAGGACAAGGACAAGGCCACCACGGACG
CTTGGTTCTTCGCAGTCTACACGGCCATCACGGAGTACGAGCGCCTCCCGATCAGCGCCAGCGAAGACATTGGCCACAAGTTCTCGGCCGTGCTCACGTC
CAGTTTACGTGATGAACACACGGAAACGGTGGTGCGTGTCTTCCGCTGTTCGATTCCATGACAGGATGGGGTGCTCAACATGTGGTGATTCTGTCTGTAG
GAGTTCGAGTTGTCATGTCAGCTGTCGCTACCTGCGCGTCCACTTGATCAGCCTAGTATCAAGTGGAAAGTCTGGAAGACCTTCGAGGAGCTGCAAGCCT
TTGACGAGTGAGTTGATGATGAGAGGTGGCGCGTTGGGACAGATTTCGTATTGACTTGCTGCTCTGCTGTATGCTTGTATAGTGAATTGCGCGTGTCATT
CGGTGCACACATGACGCAAATTGCGTTTCCGAGAGACCGCAAGCGGGATTCGATTTTTGGTGGCATACGGAAGCGGTCCTTGCAGGATCTGAAGGAGCAG
CAGCTTACTCTTTACGTTGAGCTGGTTCGTGTTGCATCTGTTACCGTTACTACTCCCTTCTTGATCATAGTTGCGGTTTGTTTGGTGATTGCAGGTGTTC
CAAATGCCAGAAATCTCCACGGATCCTGTCCTGGTTGGCAAAGTCAAAAAGTTCCTCGGCTTCGATTCCTTCTTCGAGATAACCGTGAGTTGTGGTTGCT
GAAATCCGATCCATGCGCGTAGCCTAATGCCTTACGTCTTCTTTTCGGATTGCTCAGCCATCTTCATCAAGCGAAGATGATGCAACCGATAATGAAGTCT
CGAATCTACCTGTCAGTAGTGAAACAATACCAGCGCCGTATGAGCCGCAGTTTGCCGAGGCTGACGAGGCCAGCGGAGTATCGGAACCGCCCCTGACCAA
TGAGCAGCAGCAGAATGTTGAACAAGCCGCTGCTGAACCGCTGACCTATGAGTCTCACGCACCACCCAGCCAATATTCCAGCACAGATTCTACGTTGCCT
GCGTTGCTACGTAGAAAGAGCTCAACAGCTCTGGAAGACGAGGGTGAGGAGTTTGTGAAGGTCGTCCCAGAAACTGACCCGAAAGCTGCGAAAAAGCTTC
ACAAAAAAATCATCCAAACGGTCCGCGAGCTGGTCTCTAATGACGAAGAGCGTGTGCAGGATTTCCAGGACCAAACAAAAGACTTTGGCCGAGAAAAGAC
ATCTGCCATGGAATATTGCGCCTTCCTCCTAGGTGCTGTAGGTGCGCAAGAGTGCTGCAAGCTGATCCCAGAAATGGCGAGACTTCTTCCCGATGAAGTT
AAGAGAGATGAACTGATACAGGCTCGAGCTGCGATCTGGAGACGTACCCACAGACGTCACCGCAGGCGCTCAAAACAGTTCTCGGAGAGCGTCGTGATGC
AAACGCAAAAGGAGGAGCAGCAGCAAATGGAGAATGCGCATAGCAGAATGCGCCCGAAGTCTGACAGCCTCAGCGCTCTGAACTGGGGTTCGGATCGGGT
GCAACCCATGCAGATACCGGGACGGAACTCGATGATTGAAAGACCAATGCCCGCTATTCACAGTGATTCTCGCATTGAGGCAGAAAAAAGTGCTGCACCA
ATCCCTGTTCACCGCGCAGGGGTGGCTGACCCACGACGCCACCTTAATCGACGCGCTTCGTTCAATACAATGTTCGGTGAAACATTGCAAACAGACCCGA
TCAAAGAAGAAAACCCAGCAGAAAACGACTCGGATGATGACAGCGACGATAGCCTTCTGGATAGACCGCGAGTCTCGAGCAAGGCGACTTCGCACATTGA
CCGGAAATCGTCGGGGAACGGAAACGCGGGGACGAGGCCTTCGGGCCTTGGACGCCAAAACTCGTCATTCATGGACGAAGATGAAGATGAAAGCACCGAA
GAAGATGAAGAAATGCATCACTCTGGCCGCTCTCGTCGCTCTCGCCACAGCCGCCATCGGCAACAAAGTAGCAACGGTAGTGGCAGTCTTGAGAAGCGGA
CTGTGAAGGAGAGACCTTTGTCTCGTGGAGGACTGACACGAACGCGGTCTCGCCAAAGTTCTTCATTTATCGAAAGCGACGAGGAGCGTAGCGATGGTGA
AGGGGAAGATAGCCACACGCGTTTCCGCAGAAGCCAACGCCGTGCAAGCCGCAAATTTGATGAAGAGACCAAATCTGGACCTGCGCCCGAGGAGGAGGAG
AACCCCGTGCTGGCGCGCCTTAAGAAGCAGGGGGCTATAAACTTCATGGCGCAGCTTCGCTAAGGGGCCGTGTGCATATTG