Description :
From Genome Similarity Track
Location :
Scaffold_440:17659- 21918
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_440-snap-gene-0.10F-box protein

Sequence
4259 bases(100 bases per row)
AGCAATTCCCATCGAGACACACCTAGTTTCCGCCACAATGTCGGGTTGTCGGCCGCGCGGTGCCATCGGTACGCGACCTGGGACGCGAGACAGAGACTCT
TGAGGTCCAGAAACATGAGCATGTGTTCGCGTAGTTGCTGTGTAAGGAGCGCCTCGCTACCTGATCTGTTGTCATCAGTCCAATGTGGCTGAGTAGGGTG
AGTCGCTCGTTTCAGCGAGTAGAGGCGCTGTGCGTCTTCGTTGCCGACAGCAAACTCCATCAGTGTTTTCTCGTTCGCGGCTTCGTCTTGGGCAGTATCT
CCAAATCGATTCTGGAGTCCCAGGTCACACTCACGGCGAATCAGGAGCCGCACAACGCGATGGTGGTGTTTTCGAGCGGCATAAAAGAGCGGCGTCTCGT
TATCCTCGTTGCACGCATTGATGGTTGCGCCGCGATCGAGCAAACACTCGGCGACCGCAGTGTGGCCATTGAAGGCAGCGAGATGCAACGGGGTCTCCAA
GGCATCGTTGCGGGTGTCGATAGGCCAGCCGAAGTCGAGTAAGAGCTGGATGACCTCCAAGTGACCTCGTGTCGCCCCATAATGTAGCGGAGTATAGCCA
CTCTGCATGCAAAAACAGAATAACGGGTTAGAAGATATGATCAAAAGAGATCTTGAGAACGTCAAACAGAGACCTCACCATTCCTTTGCACCGTTCTTTG
TCAATCCCTTGGTGCAGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTACGCGGCGTGTTTCTTGCCTTTTTCGCTCGCGATCAGTAGCTCGTGGCT
CAGTTTCGCGTCCGCCGAGCGCAGCATCCTCGTCAGCTGCACCGTCGTCGTGTCTTCGGCCTGGTGCATGGCATGCCGATTCGAGTTTGCATGCTTTGTC
TTGGGATGCAGGATAGCAGAATTGGCGTGTGCATGTTCGTCGTCGTCATCATCGTTGCGCTGTTGTGGTTCTTGTTTTACACGGATGCGCGAGTTTCCCG
ATTTGGCCATTTTGTCGGCGTGTGAAGCTTTCCCACAGGATGTTGCTGGCCGCTGCTTCGTGTCGACCGTCATCACGCTTGAGCAGGAACCACGCCGTGC
GACTTGAATGCGTGTCCACACTTGATGATACTGAAGCAGTGCTAGAGTGCTCAAGCTGAAGGGAGAAGCATCAAGCTCGCGTCTGTATGACCGACACTCA
GGCGCCGACAACTCCTATAAATACCGCAGATCAGATCGATTCCATTTCCTCCAAAATCAACAAGGTCCATTCAAAAATACATCAAGTGATCCAGTTGGAT
TCATAAAGAGAGCGCCCTTATTCACAAACACCTACGACGCTACAAGCTCCTGCGTTTGGTCGCCTGTATCACTGTGGAGTCGTCCCCCTTCGGCAGCGAG
AGTGCACTTGATCTGGTTGATGCCGTCGTTTGGAGCAGGAACTTTGGCGAAAACTGTGACCTTCTTCCACGCCCAGCCGAACAGAAGAGCCTCCAGACAA
ACGATGGTCAGCATGATGATATCAAATTCGAGGCGCGTCTGCCACGTGTTCACAAATTCATCAAATCTGGCGCCGTTGATGCTTGGTGGCGCTGCGAGTG
AGCTTGACAGAGCCGCATTGGTGGATTCAGCGACACGTACTCCCAACATGATGAGCTCGCCGCACCACTGATCCACGGCGTCGGATGTGTTGAGGCCCTT
GAGGAAGCCCTGTTGGACCGATGGCTTCTGCTGGATACTCTTGAGGAAGAGGTCCTNNNNNNNNNNNNCAGCCGATAAACACGTTCGCCATGGCCGCTGC
ATCGCGTGATGGCTCATCACGTGTACCGAATATCTGCATAAGCTCTGACAGCTGGGTCTCGTCGGTCGCATTCACACACAACTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGTTGCGTTCACAGTGGCATCGTGCGCTTGCACTGAACGAATGGACTCGTTCACACTCNNNNNNNNNNNNNNNCCCAG
AAAACAGGGTACACGAGACCCATCGCAACCAAGGTGAACGCAGTGACGTCGAGCAGCCGCACCAAGGCTCTGTTTGGCAGCTTCCACACGGCAACGACCG
CAACGATCGGTAGTGTGATCCCGACNNNNNNNNNNNNNNNNNNNNACGAACTCCGATAACGCCACGTACACCCACTGGATGCGGGGCACGTCGAACGCCG
CGAACGCTGATGCATGCACATCGTTTGGATCATTGCGCTGCGAGAGCATGATGAAATACCACGACGTAGACATCGCGATGAGGTTCAGCCCCACGAGCGT
GAGCAGCACGGCGCCAATGGTGAGCGGATCTGAGCGCGCGGGCGCGGCGGCATGCGGCATGACGACTGCTGAGTGCAGGGGCAAATGGACAGGGACGTGT
CCTTGCTGAGCAATAGTCGCGATAGCGTTGCTATTGACAAGAAGAAGAAAAGAAGGGACTTCGCGCTTGTGATGATGGTGCATTGTTTATACACACACAC
TACCATGGTGATGAGCAGAGATTAAAGTCGTGATGATAATCTCTTCTGAACCCATGGCTATTTTCTGCACGAGTACTTGATCCAAAGAGCTCTTTATTTC
GATTTAGGGTGGTGGGATGGTGATACATAGGATCTTCCTGGCGTGACGAGATATGCAGACCCTGGATAGCTTTTTTGTTGTTGTTGTGAATTTGGTTGCC
TTACGATGGTGAAAACGGGGTGAGCATCCACTACAACGCATGATCCCTAGCTCACTTCGTGTCGAGCGACTTTCGTGGTGGCGTTGCGCTGCTTTCGAGG
TAACGATCGTATGCGTCTTTCTCTTGCTTCAGGGAGGCTTCGAGAGCCTCGCAACCCCACCAACAGATAGCCAAGAGTCTATCAAAGATACTGAACCAGG
TAATGTCCAATGCCAATTGGTGCTTCCATGTCATTGCGAAATCGTCGAACTTGGCACCGTTGACACTGCTCGGTGGTTCTTTGGTCGCACTGTTGGAAGG
GCCTTTTGAGTTTGATTCATCATCGAGTTTCAGTGTCGATAAGATAAAGTCTCCGCACCACTGGTCCACCGCCTCATTCGTGTTGCAGCCACGTAAGAAG
TCGAGTTTCACGGACGACAAGCCACCCGCGTTTGCGACGAAAAGGTGCTGACAGCTGAGAAACACATTCGTCATGGTGGCGGTGGTGCTAGTTCCACCAC
CGCCGAATGTTTGAGTCAGCGGCTTCAGTTGCTCTCGAGTCTCTGCTTGCCTCCCGCACAACGTGGTGCCTCGTGCGTTTATAGTAGTAGTCGTTAAACC
TTTTACACACGGCAGCGCCGCGCGTGTTGATTCGCTCGACGTACTGGTTTGCGCTCTTGCTTGCCAGAACCCATACGACAATGAACGCAATTCCAAGCGC
GGCTGGCATAACCAGCATCGCTCGCATCAATCGAATGAACTTGCGGTCGTCACGAAGCGTGCAAGTCATAAGCAGTGATACAGTTGGCAGCACGAACGCA
CTTCAAAAAAAGCACTGGAGACATGCAAATAAATGCGTTGGTTCAGAGGAACCTCGAAAGGAGCGAAATCTGGTACTGTCAAGTATTTTTGATCAGAAAG
AGGAATCATCGAGCACAAGACCCAGCTTCCAACCCAGATTGTAGAGAACACGATCACAGTTAACACAGAGCCAAGCACGATGCGTTCAGCGTCACCAAAC
AACATTTTCGGTACCATCATAAGGAAGGAGGTGGTCAGTCGACGAGACCAAAGATGTCGAAATGAGCAGCCTTATGAGGGCCATACGTTTGCCATGGTTG
AGATTTTGTAACTTGATGTGCTCATGCTTGTGACTTTGACTGAAAGCCAAAAATTCATGGCATTTTATACTAACGTGGGATACACCATCGATTCAGTGAG
CTATACACAGCAAAAATAGTGATTCGCACTTCTGTTCGTTGCAGAACTTAGTATGTCCGAAAACCAACGACTTCTGTAGTACTCAAGTATCACACCGCAA
TCCCATGAGTGAAGGTCGGTCGTACCAAGATCTTACAATGCAAACAGCTCAGTTTTATTGTTGTCTGTTTCCGAACCGAAACCAACCAATACTGCAAGTG
GGCAGACCCTTACGTTCAGTAGTCTACTGCATCGCTGCGCTGTGTTTGGAACCTCATACAGATGGATTATGTACCATGATGGAGGGAAACGGATTTTTCC
GAAATTTTTTGGATTCTTCCTCATTGTTAAATTCCAATCCCCTGCTCAGAGGTATCCAT