Description :
From Genome Similarity Track
Location :
Scaffold_14:176541- 179483
Transcript NameFunction/comments
g1187.t1hypothetical protein
g1188.t1ABB55971.1 elicitin-like protein RAL8B [Phytophthora ramorum
g1189.t1RAW42994.1 hypothetical protein PC110_g884 [Phytophthora cactorum

Sequence
2942 bases(100 bases per row)
GGGTGCTCCGGCGCAAGACGGTATTCAGGGGATATGACGATGGCGTTGCACGAGTCAAGGTATGGAGCAAGCGCTGCCAAACCAGTGAAGCGGTTGCCGA
TTATCATGCCGCCCGGGTGGTAGAAGAGAATGGCAGGATGCGGCTTGGTCGGGTCGAAGCGAGACGGTCGAAAGATCGAAACCAGGATGTCCCCGTTTGG
ACCAGGAATGATACATTCTTCATGAGTGCTGCCGCTACACAGAGCAAGGATGGGATCCGCCGTGGTGGAGGCTGCCTCTGTGCGGATTGTAGAGAGATTG
TCGAGTCCAAAATGGAGTGGCATTCCCTCGGCAAACGCTTGATCAATCACTGTCCTCAGGTCAGGGTCGTACGGTGGTCGTGGAGGAAGGTTCATGGTGC
TTGCAGTGGTGAAGTTGAAGACGCTGGACTCGAGAGGTACGAGAACGAACTTGGCGGAAGAAAAAGTGATTGAGCCTTCGGGAAGCAAATCTTTACAGGG
ACGTCTCAGCCACAAATTGGCTGCGTGTATTTTAATATTAATGAAAGAAGCCACAAGAATAATATTCTTGTGGCCCTGGATGACTTCTTTCACACCCCGC
CTCACACCCCGCCTCGTATTAATAATGATCGGTGTGCAGACAGAAACTTGTGTTTGTATTTCAAAATGAAGGCTAGAAATTCCGAGCTGTAAATTGTGTT
GAGCAGTCAAGAAAAATGGGATAGCAACCCTGCGATGAGGATACTATCATACTGATGGTTGCGAGAGAGAGAGAAAGCTTGCAACACCCTTGCATTCTCC
TGACACAAGAGCGAGAAGGCAGTCTCAACCGAAAACATGTTAGCAGTTTTTCTCGCATGGGTTGGCAGGCATTCACCGACAGTCTTCCAATCCACATGCG
CCACACCGCGTACACTTCAGTGGTGTGGGTTCTTTCACAGGAGTCAATATTCAACTGAGAGCTGCTAGAAACTCTGTCTCTTCTCGTGGTACCTATCTAC
CATTGGCAGCAAGAGAATGCAAGGTGCTGTAGCCGTTCTTTCTCAATGGAGTAGGCCAATTCAAGCAAGACCGGCAATTCAAAACGACAGCCCCTCGGAT
TTCTTTCTTTTCATTCTCCAATTTGCTTCCAAGTGGGCAACCCAGCTCCAGATCAAGACAACCAAGTTCAAGCTCTGACTCCACATCGACTACTCAAGCG
ACCATGCAGTTCTGTGCCGCCACCGTCTTCCTGCTAATGACCTACGCGGCTGCAGCTGAAAACGTCTGTCCTCCGACCGAAGTCGTCAAGTTCGCCGAGC
TGTACGCCAACCCGCACCTTCATCCGTGCCAGAAAACCTCGGCCGGCTTTTCCATGGCCCCACCGATGGGCTACCCGACGGAGCCGCAAGTCAAGGCCAT
GTGCTCTTCGGATGCGTGCCATGCGCTGATCAAAGACGTTCTCGCCTTGACGCCTGGCGATTGCTACCTGTCCTTCGCCGGCGTAAAGTTGAACGTGTAC
AAGCTGGCACACAGTTTTGCAGACGCCTGCAAGACGGACAAGAGCCACGAGAACGGAAAGTACGAGCCAACACCGAAGCCCATTGATGACAAGCACTACC
CAACTCCGAAGCCCACTGACGGAAAGTACTACCCCACGGCGAAGCCGACTGAGGACAACAAACACTACCCCACGCCAAAGCCCACCCACGACAAGCACTA
CCCCACGCCGAAGCCGACCAAGGACAGCAAGCACTACCCAACACCGAAGTCGACGAACGAGGAGCACACTCAAACGAAGGAGCCGAAGGCGTTGAAGGTC
GACAGTGAGGAAACATCCAGCCCAAAGCAATGCGCTGAAAAGGAGAGCGCGGAGGATTCAGATATGAAGCCACCTATGAACGGAACTGCTGAGGAGCTCT
ACCCCATGCCCAACACAACCTACAAGGCGATCGAGCCAAAAACCTCGCTCAAGGCGTAAGCATTTAACCACCTGTGGTGCCAAACTACAACACACCAAGT
TCCTTTCTTTCAAGGACCAGACGTTCTGCAAGCCAGCGCTGCATTCAAAGTAGCTAACGATTTTCCCCACAGAACCCCAACGAACTTTTCCCTTTACTGC
CACGTGTTTCGCTTGTGAATTGATGAAATATTGACCATGAGACGATTATCCTACCCTGTAGCAATAACGCTTTTCTGCTGCTGTCAGATCGCTTCCATTG
ATGATCCCAATGTACGAAATATGGCTCCGAAACCACTCCTTCATGACCACTTACTCTACGGAGAGAACGTCGTCAATAGTAGCTACCCCGATTCCAGGGG
CACCATCCTGCTCTACCTCTGCAGAGTACACCTCAGAGACAAATGTTTTTGCGCTCAACCACACACCAGAAATCGAGCTGGGAGCGTGTTGCATCAGTTG
GGTATACACGAGTTCATTCTCATATCCAGAAGCCGGCACCGAAAACTCCATCGTCCCCGAAGAAAGCGCTGCGCAAGCGGCTGCTGCGTCGGCTTCAACG
ACCGGCGATCTTCCGAGCACCCAGTGGCGTGGATTATGCACGTCAACGCACGCAGGTAACAGGTTGGGTGTGTGGCAGTCTACACTTTGCCAAGTGGTCG
ACTCGCGCATGAGCGCCACACACTTGTTGCCATCAAGTTCGTGCCCCTTCGACACAGCCCAGATAGTTGCCTCCATGCGCTTCGGGGTGATATTGTCCGG
TGACGGTACGTTCACGCCGCAGTCTGCCACGCCCGGAAGAGACTCCTCGTCCAGCAAGTTCTCGTTGGTGCCGATCTGGCCATCAGCATTGAGGAAGCCG
TATTCGATTTCGCTGGTTTCAGGACGAAATATTGTAAAGTTCTCGTCCGGGACCCCGATATTCGCCTTGGAATGGTTAAACCGGCATTCCGGGAACGGAG
CAAGAGGCAGTGGCGGTTCCTGCCAGTTGCAAACATTGTCTT