Description :
From Genome Similarity Track
Location :
scaffold_124:17652- 22941
Transcript NameFunction/comments
g1564.t1 conserved hypothetical protein
g1565.t1 formin-homology 2 domain-containing protein

Sequence
5289 bases(100 bases per row)
TCTGCGAGGTGCACCGTCGTGGTCGCCTCTGCAAGGTCGAGGGCTGCAAGAAGCTGTCCCGCAACCAGGGCATGTGCACCATGCACATCCGCGAGGAGAA
GCAGGACTCAACCAACTTCGATGCTCCCATGAAGGCCGAGTCTGCTGTCGCTCTGGCTGTCTAAGGATGATCGTTGCCAGATCTCCTATTCTCGATCCTG
GAATCCCGTTCTTCCCTCTCTACAATCTCCGCGTCTTCGTCGTCCCTCATTCAAAGGAAGATGAGGAGGGGAAGAACCAGAAGTCGATGTCCGACAACTC
GAGCTGTCGTCTATCGCTCGAGTTTATCTGTCTCTATGTCTCCAGTTTGTATTCATCGGCGTTCGTGCCAACCAGTTTAGTCTACGTGAAAGCCTCTGTC
TCCGTGAAGTGTCCAGTATTTAACTCATAATGCGCGATGAATGTATGAACCTGTCGACCCAAGCATTTCTTGACTTTGCCTCACGTTTCCTCCACACCTT
GCAGCACCTCGACATTTTCTATCTGTTTACGTCGCGTCGATGACGGCCATTCAAGGCAACGAAAATGCGGTCGCCAGGAGCAGCGGCGAGCATTGCAGAT
GTTGGTCGTTCTCGTGGAAAGCCCCGTTGGCCGCTTCAAGCAATGGTGCCAAGCTCTCCCACGCTGCCAAAGAAGCGCTCGAACACTCTGTCCTACCCTG
CTGTATGGCTTGGCGATGGTTGCATGCCCAACAGCCGACACCGATTGGAATAGAGCACAATGCCGATTGCACAACCTCATAATACTTGCATTGGTTTGTT
TACGATAAGTGTCAGTCAGACAGTAAGTACATGCTCCGTGGGCTTCGACGACGCTTATGGCACGCCCCCGGACAAAACGGCACTGGTCTTGGGCGACATT
GAAGCTGTGGATGACACCTCGTCCATATCGTCGTCCTGCGGGATCTCCAGGTGAAGCACCCGAGCGTGGTGAATTTGACGAATCGGCTGCGGGTGGTCGA
TCTGCGGCGGCATGGCTGTCCGGTGCGGGTGCGCGGCCTTGCCATGGGTGACGTGGCTGTGGTGGCCCTGCGGCAGCTTGGCACTATGGTGCATCTTGCC
GTGCGGCGCCTTGGGCTCCTGCTTGGGCTCCACGGGCTTCACCGGGTTCTTCGCTGGCGAGAATTTCGAGTACAACCCGATCATCTCCTTCTTCATTTTG
GCCTGGTACTTGCTGTGCTCACGGCAGTACTCGGTCGTGAAGTTTGCAATGTGCGAGAGCAGCACGTCCAGCTCCTCCTCGGTGTCCTCTTCCTCGAAGT
ACTCGAGGAAGTGCGCCTTGGCCGCGTTCAACTTGTCTAACAGACCCTGCAGAACAGAGAGCTCCGTCTCCACTTCCTTGCAAAACTGCTTCAACGTGTT
CTTAGAAGTCGCCATCGCGTCCTTGTCGGCGTCGCTAGCAGTAGGACTCGGTACTGTAGCCTCAGCCTCGCGCAAAAGCTTCTGCCATCCCGCCTCGAGT
CCATTCTTTTCCGACGCAAGCGATGCGTACGCCACCTTGCTGCACTTGGAAATGAGGTCGATGTCATTGTAGAAGTGTGCAAGATGGGGCACGTCGCGCT
CAATCGATTGCACCACATACTGCAAAAAGGTGATGCCACCCACGAAAGCCTTCGTTTGCGAAAACTTGACCAGGGAGCCCAGCGAGAAGGCGTCGACGCC
TTGATGTTCGTCATCGCCGCCAAAGTTGAGCAAGTTTCCAATCTGGAGAATATAAATAAATAGTTGGCGTAGTTCTGCGCTTGAGCACACCTGGTACACG
CCTCGGGTCACGAGGTCCAGCGACACGCGCAGCTCGTGCACGCGCGACGGGAACTCCTGCTTGAATACTAGACATCCCAGTTTCTCCTGGAAGCGTGGCA
CACTGCGCACTTCCACCAGAAACTGTTCGGCAGTGCCGATTGTTGACACATCGCCGTTGAAGGCGTTAATGGCCTCCATCTCCTTTCGGTCGGGCCACAT
GTCCATGAGAGACCGCACTTGCGAAGTCGAAAGCACCGTCGAGTTCATCGCCAAAATCTCGCGCTTGAGCTCGGGGAAGGGCATTTTTACGCGTGCCAGC
GTGATGGCGATGTTCTGCGATTTCTTCATATCGATGAGCTGGACCATCGCCTTCTTCTTCTTGGCGGCAGCACCCTCAGATTTCACGGTGGCAGTGCGCT
TCTTGCTCTCCGTAAGATCCTTCACGAACAACTTCTCGAGCATAGCACGGCTCTCCTCGGAAATCTGAACCTGCTCCTTCGCCTCCTCCACGGTATCGCC
ACCCCACAGACTGTCGCGACGCGTCCGGTGTTTCTTCCCTTCCCAGTGCAGCTTCTTGCGGATCGAGTCTTTGCGTTTCAGCGTTTTCCGCTGCGGTTCC
TCAACAGGAGCGGCAGCACTCCGAGGACCGTTCAGCTCCGCAGGGTCGAGTCCCGCCAACCGCATCTTTTGCTCCACCGCGCCGCGCGGCAAGCCCATTC
GAAGCATCTGGAAGTACTTGTGGTATTTCTTGCGGTGGGCGACTCTTTCCTCTTCCGAGATCTCCGACGCAGCTGCGGGCTTCGGCTCCGGCCTCTTCGG
TGGCCCCTGCAGCCATGCCGGGTCCACACCGTCCATGCGCATCTTGTGCTCCACAACCGACGGAGGAAGACCCACCTTCACCATCTGCGAGTACTTGCCG
TGTCTCGCCTCGTACTCCTTCAGCTGTGCCTGGTACGCTGCCTCGGCTTCTGCGTCGAGAGCGGGTGCAGGTGTCTCCGGCAGGGGCTTGTTCGGGTCCA
TGTCCAGAATGGTCGGGTCCACGTTCTCACTCTGCATCTTGTGCTTCACAACAGGAGCGGGGAGCCCCACCTTCAGCATCGTGAAGTACTTTTGATACGT
TGGGTGATCTTTCAGCGGGGTTTGGTCACCACCAGCTGCGGGTGAGGGCGTGGCAGCTCCTGCTGTTGCTGCAACAGGTGCTGGCTGGATCGCTTGGCGC
TGCTTCAACATCGCAGCCAATGGATGTGCGGCCCCGCTCGTTTCCTCCTGTGCAACCGCTGGTGCCGGTGGGGGCGATGGCGCCGCTCTCCTCGCTAGCA
TGGCCTCCAATGGATTAATCTTGTTGGTCTGGGTGGGCTCATCGTCCGAGGCTGCGGGCGGCGGTGAAGATCGCTTCGCAAGCATGGCTTCCAGTGCGTT
GTTCTGGCTGGCTGGCACCTTCTCCGGGTCAACGCTATCCGTTGGCGGAGCAACTCGCTTTGCAAGCATCTCAGCCAGCATGTTACTTCTAGGTGCAATG
GGCTCGGAGATCTCCCGAGAGTCCTCTTCGGGTCTTGATACTGGAGGTTCCTGTCCCTCCTCATCGGCCTCGTCCGGCTGGGAGAGTACGCGATTGACGA
GCATATCCGCTACACTAGCGTGTCTGTCGACACCCGCGGGCATATGCCGCTGCGAGAGCATTTCCAGCAGCCCCCCACCAAAAAAGTCCTCGCTGTTATT
TCTTGACCTTGCCGGGGACGAGTACATGGAGTCGAGGTCGTCCATCTGATTGTCGCTGTCCTCGTCATCGAGTCTCACGTCGGCCAGGAAGTCGAACGAA
TCGTATCTCCTACGCTCTTTCTTCTTCTTCTGGGGGGTTCTTTCCACGGGTTCTTCGTCGGGCTGTTCCTCCTCGGCCTGTTGCCTCGCCAGCAGCTCCT
CGAGCGCGCTCTGTAATCGGCCACGGCCTCTTACTGCACCTGTCAGTTCCTGCTGGTTGTCTTCAGAAGACGTGGAGGAGGTCGCGGAGGACCCCCGACT
CTCCGGTGCATTCCGGTCCACGAGCTCCCGCACATCGATCGCCTTGTCGTCGTTCTGTGCGGCTTTCTCGTCCTCGGCGGCGCTGCCGCTATTGTTGCGG
ACGTCCCCGCCGTTGGGACTGGTGGACGTCGTGTGCCGGAAGAAGTCCTGCACCTTTTGCCGGTCGTTCCAATGTGTGGAAGTAGCTGTGTGTGTGGAGG
TGGCGGTTGCTGTACTGGTGGTTGCGGCCGTCTGCGGCTGGCCGAAGGGCGTGCGCTGGAAGCCGCTCATGGGCAGGCCGAACTGCAGCCCCTCGGCGCG
GGCCGACGGGCCCCGCACCAGGTGCGGCAGCGAGGGCTCCGCTGCCGAGGCCGGACTGCGCTTGTCGGCGCCCATGAGCATGGAGATAAAGGACGGTGCC
ATCTTCACCTAAGCGGCCACGAACGCTCCGAGAGAAAGACTGCGGAGAGGACCGCGAGAACAAAATCGAGTCCAGCAAATCGGGTCGGCCAGACGACGAG
GGCAGCCAACAGACAAGACAGAGTGGTGCTTCTCCTCTTGCAAAGTGCCTTTGCCTTTTGCCTTTGATGCCAACGGATTTCGAGCTCGGCGGTCCTTCAG
GTGTCTAGAAACGACACACAAAGGGTGCCACTGTTGAGCAGCTGGGGTCGAGTGAATGAAGAGTGGCCGCAATATGCTGTTTAGAAGTTACGGTAAATGG
GGCATCTCTGTTCGAGACGGGTACCTCCATCCATTCTGTTTGGAAGGTTAATACACTATATGAGTGTCGAGCTGTGTCAACTGGCAAAATAATTTTCCAT
ACTGGAATCAAGTCACTTGGAAACGGCCGAGTTTTTCAACTCGGAGTTTGGACTTATGAGCCAGGAAATGGCCAGTGAGAATCACTTACACCTTGACTTT
GACTACGCTCAGCTGAGCCTCAGCCGGTGTCTACAGCTCTACACACCCCGCGGCTGAGCCACGACCAGCAAGGCCAAACAAAAAGGCCACTTTTTTCGTT
GCCTGGCCTGGTGGTGTGACAAGCGGCGCTGGCCAAGTGGCTGCTGCGGGCCCCACATGAACAGCCCTTCAGAAAGCGAAGGCGACAATCGCTACTCGAC
GACAATGGCGAGCAACAAGCCTTGCGTCAGTGCCGCTGGCTTGCCCGGAACTCGCCGAGCACGGGCCGTAGGCACGCACACCAAGAGATGTGGCTCGCAC
TTGATATTTGTATGCAATACCGTTGTTTCTCTGACTTTGATACATCTCTTTTAGAACTGCAAAATATGATTTTTGGATAAAGTGAAAACCATTCATTTTG
ACGGCTAAACAAAATATTCCTCTGATATCCGATGCAAAGAATTTGATTAAAGCATAGTTCTCCGCGTGGTGGACCATATTGCGTATTTATTGAACCTTCT
GGCTGTCTCGTCTGCATGTGTACGGTCCACTTTCCTCTCCAAGCGCATACGGCCCGCCAAAGAGCATAAGCGTTCTTGGCCGTGCTGAC