Description :
From Genome Similarity Track
Location :
Scaffold_130:17651- 19005
Transcript NameFunction/comments
Phyta_totarag4212hypothetical protein PHYSODRAFT_396891

Sequence
1354 bases(100 bases per row)
CATGGTGGTTGGCAAACTCTATTCTGTCTGAACGACGACCGCGTctgcttgaagttgttcaTTTATTTTTTGTAAACCGAGCGGAATAATTACTCATTTG
CGGGGTTTGAGCTCGAACGAAATCGACTTTTACTAACAGCACACCGCGGTAGTTGCTGACACTGCTGAGGTGGCGGGTATTAAAGGGGCCCACGACATCA
AACGGCTGCAGGAAGATGAAATGGAGCATGAGCGTAACTGTAAAAGGATTTAACTGTATGTATGGTAGTGCAGAGgccgtcgctgcttctgttCAGGTTT
GCTACTACTCGCGGTTagccaaggccaagctctCCGCCATCGCCGTGACGACGCGCTCCGGACTCTCTAAATGCGGATAGTGACCcccttcgtcgtcttc
aaagTGCTGAGCGTGAGGCACTGCCGCAGTGAACCACTCGAGCTCGGCCTTGACATCAGCGTAGTCTGGATCCCTGCCGCCGAAGAACGCAAGCACCGGC
AGTGTCGGATACTTTCCGAGATCACCGAGAGTAGACGCGACTCCAACTTTGCTGGCACGAACGAAGCGGTCCACGTTTACGATGTTCCCCGCATGGGTGC
TCAAGTGCTTTTTGAGTATGTCGAGCTCCGCCTCGAAATCAAAGGGCAGCTTTCCCGGGAAGAGGGTCTTGTAGTAAGCTGCCCAGACCCAAGCGCCGTA
TAGCGAACGGAATAGTATATGCGAGAGAGGTCTGAACCATGATTCCATTGGCGAATCTCGCAGAATAGGTCTGAGCAAGACCAGAGCGTTGATACGAGGA
CCCGAAGGTGCCTTTTTGGTTGCAGCTGCGGCGAGAACCATCGACCCTGCACTGAGCGAGTTGcccaacagcacgaagctgGACGTTGGGTCGACaatca
tcatcttctccatcaagcTCGTCACATCAGACGCGACAGATTCCGATGAATACGCTGAGTATTTGTCCTCCTTGTTGTCATCGAATGAGGTCGAGTCGCC
GAAGCCGCGTAAGTCCCCAAGCAACACGCGCAACCCCAGTTTGTCATGCAACAGTGGTGCAAGCAAGCGGAACTGGCGTCGTGTGTCTCCAATACCCAGT
AGGCAAATGGCGACAGTGCTGCCAGCAGGGGCATCTGGGCGCGAGtcctcgaagaagacgtAGGACTGAGGGGAGGCTTGGAGGTGGTAGTCCTGAGACG
AAGCGAAGACTCGCGGAATGGTGACCTTCGACTTGGTCTGAGGCAAAGAAGAGTTGTCCATGGATGCTAGTaatggtggtggtggttgttgctgtgaaCG
GTTTGTGGCGAATTGCGAAGTGAGAAGCATCAGAGGACAAGTGCGAAGTCAGTC