Description :
From Genome Similarity Track
Location :
Scaffold_8:176508- 177613
Transcript NameFunction/comments
g3354.t1ETP23394.1 hypothetical protein F441_03484 [Phytophthora parasitica CJ01A1

Sequence
1105 bases(100 bases per row)
GCTGAAGGGGCATGTGGCCGATGTGACCAGTGCTAGATTCTTCCCCAGCTCGCAGGTTGTGCTCACAGGGTCGTTGGACTTTACGCTGAGGATCTGGAGC
GTTCAGGGACAATGTGCTGCGGTGCTCAAGGGACATCGGGGAGGTGTGGAGGATGTGGCCATTGTGGGAAGAGGACGCAACGTGCTGTGTGAGGATGTTA
GGGGGGGAGATACTTGTTTGTCAGTGGGGTTGGCTTGTGTATTGACTGCTTTTGATTGTGTTTTCGTGGGATCCAGCGTGTGGAACTGATGGGCTTATCC
AGCTGTGGAGCTGCGCGACTCAGGATGTCGTGGCCAAGTGGGCTAATGATGACCAGAGTCCTGTGCATTGCTTGTCAGTGATGGATGACACTGCTCAGCT
GCTGGTGGAGGGCGAATACCCGCCGTCCACTAGTGAGAATGAGGCCGAGACAGGTGGTAAAGTGCTCTTTGCTGGCCTCGACAACGGCGAAACGTTGGGT
GTGGACGTTCGAGCGCGTGAAGCGGTACGTTTGTCTGTAACGTTATCAAGTGGGGCGGTTTGGTATTCTACTATGCACGAGGTGTTGATTTGTTGGTGGC
TGTTGTGTGTTGAACAGGTGCTAAACGTTGATTGTCTTGCCGGTTCAATCACCTCGTGCGCCTCCACCACTGCGAATGCCTCCGTGCCGATGCTATTCAC
AGGAAGTGAAGACGGCCTGCTAACGGTTTGGGACCTTCGCCACACCGGGTGCGTCTGACAGTATCGCGTGTTGGGCAGGATATTTTTCTTATGTACTCAC
CGGATCTGATGCTGCAGGACGCCGTTGCATGCTCTATCTCGGAGCTCCTCTCCGATTCATAGCATTGCTGTCTCGGTGCCGTCTCCAAATGAACCAGCAT
CTGCTGGAAGTGTCTGGACTGCTCATGGCGACGGTGCTTGCTGTAGCTGGAGCAACTTCGGTGCACAGCCACATGTGTCCACGGAGCTAACCGGCCCGCA
GTACGATGCGGTGCGTGGTGTGGCACTCGCGAGCCAGACTGGCCGTGTGTTCAGTGCCTGTCGCGACGGGCGTCTGCGCGAGTACATTCCGCATATCGTC
ACGTG