Description :
From Genome Similarity Track
Location :
scaffold_1297:1765- 4913
Transcript NameFunction/comments
g11260.t1hypothetical protein

Sequence
3148 bases(100 bases per row)
CCCTGTCGTTCCTGGCGCTTTACCGCTTCGCCACTCCTTCCGACAAGCTGCAGCTCGTTCTAGGCGCCATTATGGCGGGACTGAATGGTGCTATCTTTCC
CTGTATGGCTCTGGTCTTCGGTACAGCCATCAACGCCTTCGCACAGGCGGACGGAGGCGTAGACCGGGACGCCGTGAATCGAGCCGCCCTTTACTACTTC
CTCATTGCCCTCGCGCTCTTCTTCACGGACTGTTTCGCTTATATTCTCTTCTGTAACTCGGCCGAGAGGCAGATGAAGGCTCTCCGCGGTCAGGTGTTCG
CTCACATGCTCTACATGGACGTGAGCTGGTACGACAAGAGCGACGCCTTTGAACTCTCGAGTCGAATCACAGGCGACACGGTCAAGATCAAGGACGGCAT
GGGCCAGAAGCTCAGCGACTCGATCAAGTTCACGTGCCAGTTCTTTGTTGGCTACATCATCGGCTTTTCTCGAGGCTGGGATATGAGCTTAGTCATGGCC
TGTGTCATGCCTGTCATGGTGCTCTCGCTCAAGTACATGGTGAGGCTGTTCAGGAAACGAGCGGTGCTGTCGCAGAAAATGTATGCTGAGGCAGGTGCTG
TGGCGGAGGAGACGCTCGGCTCTATTCGTACGGTTGCATCACTCAATGGAGAGAAGCGTGCGATTGACAAGTACAATGAACGCGCGATTCTTGTGGAAAC
GGGAAACATTGCTATTTCCAAGCGATCGGCGTGCGTCTTTGGCTGTATGATGGGGAGCATTTGGCTCATGTACGCTGCTGGACTCTGGTACGGTGGATCT
AAAGTGGCGAGAGCGGAGGCGTCTCCTGGAACAGTGTTCCAGGCCTTCTTTGGTGTGCTGATGGGAACGATCTCGCTTTCTCAAATTTCCCCGAACATCA
CTGCTGTCGCGGAGGCAAAAGGAGCTGCTGCTGCAATTTACAAGATCCTTGATACCATTTCGGCTATTGACGCTTCGAAAGACGATATCGGAGTCAAACC
AGACTCGTGTGTTGGGCGTATTCAAGCACTGAGCGTCAACTTCACGTACCCAAGTAGACCTGATGTGCAAATCCTGAACGACTACAATGTCGCTATCGAG
CCTGGTCAGACTGTAGCCTTCGTTGGTGCAAGTGGAGGTGGCAAGAGCACTCTCATCGCACTGCTCGAACGCTTCTATGACCCCCAAGAAGGTACCATCC
TACTCGATGGACGCGATATCAAGACGCTGAATGTAAAGTGGCTGCGCTCGCAGATCGGGCTGGTATCCCAAGAGCCCGTGCTGTTCGCCACTACCATTTT
CGAGAACATCGCAGCAGGCCTGGAAGGTGTTGCCCGTGACCAAGTCGTCGCGGCCGCCAAACTGGCCAACGCCCACACATTCATCATGTCTTTGCCGGAG
CAGTACGACACTCTCGTAGGTGAGAAGGGTGTGTCATTGTCGGGAGGTCAGAAGCAGCGAGTGGCAATTGCCCGAGCCATCATACGCGAACCCAAGATTC
TGGTACTGGACGAGGCCACAAGTGCTTTAGATAATGAGAGTGAGCGCGTGGTGCAGGCGGCACTAAACGATTTGATGGACAAGACGCACATGACGACGTT
GGTAATTGCTCACCGACTTAGCACAATTCGCCGTGCTGATAAAATAGTGGTGGTGAATGCTGGTCACGTGGTGGAGGAAGGAAATCATGATGAGTTGGTG
TCGGTCGAGCATGGTGTGTACCAAAATCTGTACAGGATTCAAGAGGAGAAAGCGCAGGAGGAAGCCGAGGCAGCTGCGAACGCATTGATTAAAGCTGGTA
TTAACGACGACATTGATATGTCTCGCACGTTAAGTAGTCGCTCGCTTGGAAGCAACCGCTTGGTTGACGATTCTGTGCTGAAAGAAGCAAACGAAGACGT
ACCGGAAGGTAAATTCACGATCGCGGACGCATTGGAGTTTAGCCGCCCCGAGCGCAAATTTTTTATCACTGGACTTATCTCCGCCGGTATTAACGGATTC
TCGATGCCGTGCTCGGCTATACTGATCAGCGAAATGGTCGCGAGTATGACAACCGCATACACCAATTACCAAACGTATGGACTTCAATCGTACTTGGATC
ACCTTTCAAGCGATATCACGATTTACGGCGTGTGCTACATTGCTGGAGCTGTCGTTTTATTCTTCACGAATGCCACTCAGAACTTTTGTTTCCGCTACAT
GGCCGAGAAGCTGACGTCGAGACTACGTGGTATTCATTTTTCGGCTTTGTGTCGCCAGAATATCGCATTTTTTGATGAAAAGAAGAACGCCACAGGAGCT
CTGGCCGCTGATCTTTCGACGAATGCCACAAAAGTAGCCATGATTTCTGGAGATTCGCAAGGCCGCGTTGTGCAGGCAGCATTCACGTTTGTAGCGGCCC
TGGTGATTTCATTTACAACAGGCAGCTGGTTGTTGACTCTTGTCATGCTCGCGGTGTTCCCACTGCTTATCATGGGCCAAGTCATTCGGATGAAACATGT
CCGACATGGGAATATTCTGTCGGACGAGCTTGCAGACGTTGGTGCACACGCTTCAGAAGCGTTGACCAATATTCGTACGGTCGTCTCGATGGGACTGGAA
AAATCCATGACCGACAAGTTCAACCTTTTGCTCGAAGAACCGCTAGCAAGTGGGCGACGCGAAGCTCGATTGAACGGTGTTGCGTTGGGGTTCAGCTCTT
TCATTGTTTTCGCGACGTACGCACTCGTCTTCTGGTATGGCGGGAAGCTGGTTGATGGCGGGGATATCACGTTTGCTAAGCTTATCCGCACGCTAATGGC
CATTATGATGTCTGCACAAGGTGTTGGTAGCGCTGCTTCATTTTTGGGTGACTCTGACAACGCGGTCAAGGCTGGTAAAGTAATTGTTGCGATCAAAAAT
CTTGAGCCGCCAATCGACTCCTTCGACGAGTCAGGCTTGAAGCCATCCCGTCTTGAAGGTAAGATTGAGTTCAAGAACGTCTCCTTCCGATACCCCACGC
GACCTGAGGTGACAGTCCTCCGTAACTACAATCTCACTATCGAAGCTGGACAGACGGTGGCCTTCTGCGGACCAAGCGGTGGAGGCAAGAGCACGTGCAT
TTCGCTTATCGAGAGGTTCTACGACCCCATCGAGGGCCAAGTGCTGCT