Description :
From Genome Similarity Track
Location :
Scaffold_64:176473- 191953
Transcript NameFunction/comments
Phyci_584548Hypothetical protein
Phyci_9645Hypothetical protein
Phyci_82041conserved hypothetical protein
Phyci_94185Hypothetical protein
Phyci_512495Hypothetical protein

Sequence
15480 bases(100 bases per row)
GAACACAAGCTGCTGCTCACGCCTCCGTTCTCGCTCACGCACTACCCACTTTCTCCAGGCATGTTGGATCTTACGTACGTTGGCTCGAACTCGTATCGCT
TCCAGATGAACTTCAAATGCAGCTTGCTGTGCACGCCGCCGCTCGTTCTCACTCCGGACCCAGCGTCTCCACGCTCCCTGAATTTTGCGTACGTTTGCTC
GGACTTGAATCGCTTCTAAATGCGCTTGAAACTCGAGTTGCTGTTCTCGCCTTCGCTCTCTTTCGCATGCAATCCAACGATGCCAACAACCTTGAATCTT
ACGAGCATGGGCTCGAATACGTATCGCTTGCAAGTGAGTTTCGAATGTCCGTTGTTGCTGCAGCCTTCGCTCCTTTTCCCGAGTGACCCAACGTCTCCAC
ACTCCCTGAATTTTGCGTACACTGGCTCGTACTAGAATCGGGTGCAGGTATTCATCCAAGGCAAGCTGTTGCTGATTCCTTCGCTCCTGCCCATACTGAA
CCCAACGATTCCTCGCTTCAACGCGGATAGCCTCCAGGTGAGCTTTGAACGCCAATTGTCGCTGGCGTTGTCTCTCTCGCTCGCATACGATCCATCGCCT
CCATACATCTTGAATCTTTCGCGCGCTGGCCCGTGCACGTATTGAATACAGATGTGCTTCAAACGCATGTTGCTGCTCCATCCTTCGGTCCCGCTCAGAT
TTCATCCACCGTCTCCAGACCACTTGAATTTTACGCACGTTGGTTCGAACACGGATGGCTTCTAGGTGAGCTTCAAACGCTTGTTGTTGTTGAATTCTTC
GCCCTCGCTCACACACGACCCAGCATCTCCAAACTCCCTGGATTCGACGAACGTTAGATCGAACACGTATCGCTTCAAGATGAGCCTCAAACGCTAGCTG
CTGCTCGCGTCGCCGCAGCTGTATCCACTTTCGCCACCAAGCTTGTATCTGCCGAGCTAAAGCCTGACGCCGTCTAGCCAGCTCCAGCTGAGCTAGTTCC
AGCTCTTCAGCTCGCTTTACGTGTTGTTGATGGATCCATCGATGCCATACCCGCTGGATCTTTCGAGCAGAATTCATGCTACGCAAGTGCTTCAATCTCG
CGTACTTGTGCTTCGTGGCCTTCTGCAAATTCAACACACCACCTAAGCCCTGCATAATGCCTTTACTGCTTTCGCTCTCGGACAGCAACTTGGCGGTGAT
TATAACTTGCACTACTTGTGCTCGAGTACGCTCAGCGTTAGCCTTCTCAAAGGCAGACTTTTGCTGCTGCTGAATCCGGATCAGTTCTACTGTTCGATTG
TTGCGGTGCTGGCTGATGCGCCGATGTATGGTACTTGAAGCCTTTATCGAGGTAACTTCGCGGATCTTGGCTTCAATCTCGCGGCGCTGTCTGCGTTTTT
CCTCCTCCAATTCGTGAGCTGCCGATTCACGGATCACAGCTTTCTCCTTCGTGAGTTTCGACAACTGAACCTGCCCAGAAACCCATGAAGCTATCTGCTG
CATACTGGCATCAATTCTGCTGCGTTCCAATGCCGCTGCTGCTCGCTGGGCCTCCTGCTCCTTGTCCACCTCCAATTCATTTTTTGCTACTAACAGAGCT
TCCGATCGCGCCTCAAGTTCAGACACACGCTGCTGAAGATCGGATGCGACTGAATTTGCAGTTCGTCGTTGTTCCATTTGGTCTTCACTAGACATGAATT
CGACCTCAATCTTCTCCGCCTGCAGATAGGCTTGCTGTCGCAAAAGCAGGTGCCGCTCCCGCTCGGCTCGTCTACGTAGCACCCGACCGTCAACAAAAGC
CTTGATCTTTTGTCGGGCAGCACGTTCTTGAGAAACTATTTCTCGGTTTTGGTGCGCTTGGACAACTTCACGATGGCGTGCATCGGTTTGCAAAGCTTGT
CGAGTCATCCGATCAAGCTTACGCTCCAGCACCCGTACTTGGGTGCGGGTCTTCCCAGCGTACCTCTGAGCTTCCATTCCTAGTTTTTCTTTCGCGAATA
ACTCGTCCTGGAGCTGCATTTCATACTTTTTCTTCTCTAATTCAGCACACTGCAACTTCTTGTGAAGACAACACACCCTGAAGAACATTTGGAGCTTTAA
CGCGGCAAGTTTTCTTCGCCTCACCTCAACCGCTTGCTGCTGCTGTTGTACAACGCGTTCGTGGTGTGTAAGCAGCTGGAGTCTTTCCTCTTCAGAAGCT
TTCCACTTGCGGTCAAGATCTGCCAACCTTGTATTCATATCTGCGATGAGCTCACGGCGATGCTTCGAGTTGATCTTCATGCTCCTCTCCACATCTCGCT
TCGCCTTTGTCCACTTCAACTGCTCCTTGAACAAAATTTTCTTTGCCATCTCTTGAGCTGCTTTCAATTTGCGGCGGAGTAAAACCTCCTTCACGAATCT
CCGGATGTCTTTCAGAGCCCTCACTCTTCGCTCTTTTTCGCGAGCAAGTTTTTCCTCCCGCTGTTTTTGCTTCCTGATTCGCAAGCGCTGCCGTCTCCAC
CACCGAACCAACTTTTCCTTCGCAAATTCTCGGATTCGCCGCCGCTGGGAAATGCCCACGTAGAATAATGCACGATAAAATGTCATGTGCACAACTCGAA
AAACAGCTTTTCGTTGACTAACTTCCTCGTTGTGACGATACACTCTCCAATTCCGCTGTATTCGTGATGCTGCAAGGGATCGAAGGCGGTTTTTCTCGTC
TATCTGAGCCTGCAACCGTCGCCGATAGTGGAGGCTAACGAATTGTCTGACTTTTCGCATTGCAACAAGTCTGCGAACGACGACCCTCGCTCTCTGTTGC
TCACATACAAACACTTTCCAGGATGCGAAGTTGCGGCGCAACATCTTCAGCTCGCGCTCCAGATACTTCGGGGCAATATCGACGACAACAGGTCGAGTTG
TGGGCGATGAGTACCCCATCAATGATGAGAATGGCTGAGCCACCGACTGAATGTGGTCTTCCACCTCGCGCTGAGATACCCAATGGCTCATATCATACGC
TGCTACCTGAATGTCTCGACAGAGTGCGAAGATGCGGTTAAACTCAGAAGGCTCGCTTTCATCATCACCTTGATAGCTGGTAGTTGTCGAGATATCACTG
CGAGATGAAACGGGTGGCGCTTGTGTATCCGTGTCACTCCGAATTGAGCTAGATGAATAAGGTAATTCTTGATCGTCAACCACAACTTCCTCCGGACCGA
CATCATCTAATGATGGATGTTCGTCCCCCAAAGATCGATAGGTGCTGAGTTTGGTAGAATCAATATCTGTTCGATTTTCTGACTCTCGCTCTTCACGACC
AGAGAATGCGTTGTCTCTCCAAGTACTTGGCAGAAGACTCAATGCCATAGCAATATTCGATATAGCTGTGCTTGATGAGTACGCGTACTCATCGTCTTCT
GGCTCAGGAGCCTCCGCTCTTTGTTCGACACTTTCCAGCTCACTTGTAACATTTTCCATCGACAGAGTTAATTCATTTAGCGTGGACCGGCCGGTTGATG
CAGGGGATACGTTGACGCTCAACACTGTTGTTGATGCACTCGGTAAGGCAATATTTTCAGCAAACGCAGTTTCATGTTCATCCGTTCTGCTTGATATCAC
ACTCTCATAATCATTTGGTGGTATAGCTTCCTCGGGTTTTAACACTTCATCATCTAACGCTGAATCCGTGCTCGACAACGTGAAGTTAGGAAGCATTTGA
AGTGCCATAGCAATACTGGATAATGCCTCATTGGACGAGTATTCGAAGTCGCAATCATATCCGTCGTCAAGGCCCGCTATGACGTTAGCGTTAGCTTCCA
ATTCATGTTCAAACCCAGTACTTGGTGTTGTCACGGCATCGACGGCACCACTCAATCCTTCATCAGTTATGTCACGTGAGGAATCTACAACAGAGCGTGA
AGAAACGTGCTGTTCAGCTGTAACAGTACTCAATCGAACTAGATCGGTGCAGCTGGCAAAGTCGTCAAGTTCCCTAGATTCCGGGAGATTGTTCTCCATA
GGGTCGGTAGCAAGGTTGAGTTCACCGGTTTTGGGCATGCAACCGTCTTCTCGCTCGATTAGAACGGACGGTCTCCTTGCACTTACAAGATTCGTGGACT
CGTCTTGATAAACCTGCATCGCTTCATCTCGCATACGCCGTGTGAGAGCATTTACTTCTGATCGTCCCGATGTTGGCATATCCTGTTTTGGAGAAACAGC
CAGCGATGGTGTGCTGCGCTCACTTATCTGAGTTCCAGAATCGATGAAAGATTTACGGCTGTCAGGCTTTTCGGTGACCTTGCTGCTTCTCCTTTTCGAT
GCCGCCCGCTCGGAATCGGTGCTTCTGCAAGACGATTTGGCTATTGCCGACATATCGAGCACGGGTGGTGGTAAAACCGAACGAGTAATTTCCACTTCGG
CACTTCCTTCATTCCCAACAGAATCGTTCTCGGCAAGTATGTTTCGTGCGGACGGTGGGGTGCTAGAAGCTGGTAGAGGAGTATTAGGAGTGGTGGATAC
CGTCCTCGCAGGGAGAGACTCAAGCGAGGTTGGCATTGGTATCCATACCGACGACGGTCGTCGAGTGTCTTCCTCTTTCTTTGTCGAACTTCGAGATGCA
TCATTGGAAGGCTTGGGCGACGACGATTGTCGGTGAGGTGTATTCTGTGCAGAAGCTGCCGAGTGTGTAGACTGGGGTTCAGGTGCAACAGGAGCCTTCG
GTATTGGTGAGCCCGCCCACGCTTCAACCACAGGTATCCCACGAGGAGGGCCATAGTCACTTGATTGAGATACTTGAGAGTCCTGACGATCCAGCTGGTG
TATCCTTTCGTCTTCAAACGTGCCGTACCCATACGACGCATTATCCACTCCGCGGGGTTGATGCAAATATCTCTTGCTGTCGATTTGCGATTGCAAATAT
CTCGGGATCATTCGAACAGCATTGAACCGCGTTTCAAGGTCCATCAAATGCAGTAATGCTGCTGCCACACGCTCTGCGGGTAGAATTTGCCATCCTGGAA
GGTACCGTTGAGTTTGCAGCGCAAATGTCTCCAGCTTTTGCTTTAATAGCCGCAAGAGAGACGAAGGGGTCGACGCAGCAGAGCAAAATAAAATGCCGGA
CGTGGCACTCTGATGACAGGAACAAAGCAGTACCTCTGACGAATCCAACGATAATCCGTCTACGAATGGGTTGCGCGTCAAGTTCACCTCAAAGTCCTCG
AAAAAGCGCTGGAGTTGTGGCGAGCAAGCCAGAAAATCCGAGTCGGACGTCATTTGCAGCAAATACCCGAAGAAATCTTGCTCCAAAACTTCATGCTCGA
CACTAACACCCACGATGTTAGAGTCTCCCAGCTCTCCGCTCAAATACACCACCGCTTCAACAACTGCAAGAGACAAACTTCGCATCCTGTTCAGCAGCTT
CACTACTCGTTGCGGCACATTCTTCTCCACGTGAGATGCTCGATGCAACGGCAATACACCCATGATCTCTTGCTGTAAGTGAGCGAGCACCTGGTCGCGT
ACATGCATGTTCTGCCGGATTGACTCCATGACGAGATGTGCTGGTGATTGCTGCATGGTGGGCGAACGGATTGCACGCCGCGTGGAGCCACCACTACCCC
TTTGAGGAGATTGCTTCTGGTGGGGTGTTGAGTCGTTTCGAGTGTCTAGCACCTGCTGCTTCAACTTGTATGGACTTGACAGCCTCTTGGCATTAAGCTG
CTGCATCTGACGCTCCGTGAGTGGCTTGGGCACTGCACCTTGAGGATTCCTTGACTGCAAGCGCTGTCTTGGTTCGGCCACGTAGTCGCTGTGCTGGAGA
TGTCGACTGTCTCCGGCGTAAGTTGATCTCCTATCTGGAGTAGGATACCACGGCGCGCGATGTTGCTCAATTCCAGCTTGCAGGCTGCCTTGATACAGCG
AGTCATCCAGTTCTAACTCCACCAAAAGTCGTTGCTGATCATGGCGTCGACGCCCGTCGAAGTCCGTCGTTCTGCGCTGCGCGGGAGCTCTTCCATCTCG
GCCGAAGGTCCGATCACCCATACTACCCTTTATATATAGGCAAAAATTGCCGAATGCTGCTCTCGCCCATGAAGCTCCTTCGTCGCTTGAAACGTTTCGT
GAAAGCGTTTCGGGGCCTTCGCAATACCTGCGCAAAAACTATCAAGATGAAGCCAACAACGAAGCGGTAGAAAGCTAGCCGCGAAGGCTAGATCTGATAG
CTGTCTTTAGTTTTAGCGGAGACAATGTTAGTTCCAGTTGTGTCTAGATAAGCATGTCGTCGTCCTCCTCTTCATCACCGTTGGTTACAGTCGTGAGGCC
CTGGGCTCGGTACAAGTCGGCAATCTAGCATGACAATCGAATACACCAACGATTAGCTAACTACCCAATAGCATACGGTAAGCAATGACAGTCGAGTCGT
ACCTGAGAAGAGTTGGTCGCCTGCGTGGTATCCTTGTCGTCACGGATGCGGATGAAGCGAGGGAAGCGCAGCGAGATACCCTTGTCCTTCGCCACGAGGC
CGATGGCTGCCGTGTACTTGGGCGAAATCGAAAGGTCAGCACCTAAGATTTCCCACACGCAGCTAGCCTCGAACCAGACGTCAGGCTTGATTCCGTCGCC
GATAGCATAGTCGCTAGGTGGCTTGTCCACCACCTTCTCCTTCAGTTGGTCGTAGAACTGCTTGAGCACTTCATCCGACAAGCCAGTGCCCAGCTTCGTA
ATGGGCTGGAACATCTCGGTGTCCGGATCATAGCATGCAAGCAAGTACGCGCCGTAGACACCAGTACGCTTGCCCCGACCGTGGAACGCACCGATCGGGA
CCAGATCAGCAGAGTCACCAATGCCATCGAGATAATCCTTCTTCAATTTGAGCCATTTGTGTGAACGGTTCGCAGGTTCATAGGTTGCCTCCTTCTCGAG
AGTCTTCACCATCAAACCCTCGCAGTTCTCACGCACGGCTTCCTCCAGGAACGTGCGCACCTTATCCACGGCTTCATCCATTGCCTCGGGGTTATTCTTC
ACATCAACGCAATCCTCTACGTCCAATGATGTAGCGAATTCGAAGTTGCCCGGCTTCACCTCGAACATATCCCGAAGCTTCTCACGGCGTTGTGCGAGCG
GAGTGGAGAGGAACGACTCACCGTTCAAGAACAGCAAGTCAAACGCGTAGATACACACAGGCACCTTAATGTCTTCCACTTTTACGTTCTGCAGGTAGGG
CAAATAGGCGTAGGAACGGTTAGTAAGTGCAAAGTACATCATTAGAATTCGATGCCGTACCTTTCGGGAGCGCGTGCTCAGAATCTGGAATGGCAGGCGC
TTGTTGGTGGCACGATCCACAGCCACCACCTCTGCGTCGACGATGCAGCTTTTGACAATACCCTTCTTCTTGGTAGCTTCTGAGATGGCCAACTTGACGT
CTGGGAAACGCTCCGTGGAGTTTTCGAAGTTACGCGAGAAGATGGCAATTTCTCCGTTCGGGAGGATGTGGATTTGGGCACGCTCACCATCGTACTTGTA
CTCACACGTGAACGGTTTGCCTTCAAAGCGATCAAAGACCATTGCGTATGCCTTTGTCGGTCGCGCAAGCATCGGTGACACCGGTGTACCTGGAGTCAGC
ACACATTTCTCGGCGACCTTGGCGAAGTCCTTTACACGAAGGAAAGGGGCACTAGTTACCTCCTTCTGGACTTCATAGAACGCAGCAACGAGAGCGTTGT
AGCTGGGGCACTCAGCGAAAGCCTTCTTGACGAAGGCAAGAGCCTCTTGCTGCTTTTCCTTGTCCTTGTAGGTCTTGTCCGTCATGAACGCGTACGTCAA
CCCCATCAGAATCGACTTCTCTGCCAGACCGATTCGAAGTTTACCCTGGAGTCCACGAATGATGTACTTGGCTCCTTCGGCAGACTGCGCGCCGTTGGCT
TGAGATTTCTTCTCCTTCTCGCACTTCACCAACAGGCCCTTGATGATGGAGCACTTCTGCTGCTGCGAGTTGTTTCCTGTCATCTTGGCAATCTTGACGA
ACTGGTTGTACACATGCTGGACGGTGAGTCCGCTGCCTTTAGACGCTGCGGGTTTCATGGACGCGAACGAGAGCGTTTTCTGCTTGGACCGCGCATTCTG
GGCAACCTTACCGAGGTCACCCTCTTTGTGGTACATCTCCTTGATGAACTTGAGGTTTGCGCCCGTAGCCTCACCAATGGCCTTCATCAGGATAGCATCG
CCAATACCGATCTTGAGGTTCTCGAAAGGCGGGGCCAGGTCGACACACACGCACAGGTAGATACAAGCCAGCAGGTCATCAGGTGAACGCCGGATGACGT
CGCGGAAGAACGCCGTGAGCAGATCCTGGATGACAAGACGGCCCGTGACCTCCTCGATCTTCGCGAACAAGTGCGCCAGAGCGAAGTACGGGGTTTCCCG
GGGTTCATCGCTTTCATCGTCTTGGGTTTCACTAGCATCAGTCTTCGCCTTCGGTTCCAGGTCATCCGTAATTTTCTTCTCTTTCTTGGCGTCGGCCGGG
GCTGCCTTCGCCTTGCTGTTTTTGCTAGACACTGGCGAGAAAAAGCTGGCCTTCGTGCCAGCAGGCGACGCCGGTTTTTCTttcttcgtcttcgtctgct
tcacctcctttttctctttcttctccttctCCACctcctgtttcacctctttctttgtctgttgctttggcttgacctcttccacttcttccacctcttc
aacttcatcctcgtcgtcctcctctttcggactaggcggcttcaccgtcttcttctttttctcctccttcttggggctcttggctttcaccggctgcctc
gtctccttcttcttcGGACTCTTGGCCTTCTCAGGCGTCGACGCCGGCGACGTCATGTCAATCACCTCGTCCTGCTTGGTCTTCGCCGTCTTCTTGTCCG
TCGACATGGGCAGCTCCAAGTCGCTGTCCTCGTCCTCGTCCTCCACGACGCGCTGACGCAGGCGACGACGGCCAGCTAGCAACGATAAAAAGAAAATAAA
CAAAATAGTCAGTCAGCCTCCAACTTTCTCCTCCTTCACCAATAAAAAAGAGAAAATCCACGTACGCTTCGTCTTGCTCTTGACAACCtcctcttcctct
tcctcttcttcctcttcttcttcttcttctgcgcccggcatctcaatgtcctccggctcctcctccacgtgctcctccttctcttcttcttcctcttctt
tttctttcatcttctccttctcttctctcttcttctcttgtttctcctccttcttGGGCTTCTTCACGGGCTTGGGCGGCGCCTCAACGGATTTCTCGAC
GTCGTCGTCGTCCGCAGCCTTGCGCTTCTTGGCTGGCGGCGGCGTGGACGCCCCCGCGCCGAAGAACGACCtaaataaaaaataaaaaataaaaaGGTTA
CACTCCTGTATTTATTTATCCATCCAAAGGGGTTACGCTACGCTACGCACATGATGGAGCGCTGCGTCTTGGGCGCTGCTACATGTCGCAACCACCAGCA
CCATGTCAGCTCGTGTATCTACCCACAGAGTACCCCATATAACCCCATACGCACCTTTCTTCCCCATAACCACCAGTCACTCCCAACACCTGCAGCTTTT
TTTTTTTTCGCTACTGAAGCAGCAATTGGCGCGCTCAAAAGTGTACCCAACATACCCCACCATACCCCCATCAAAAAAAATGTAGCCAAAAAAGCAGGTT
ACTTTTGTTTTTGGCGGGAAAACATTTCCAAAAGGGTTACACCGTGACGATCTTCCAGCAGCGACCGTAACCTCCATGACCCGCACGCTGCTGGCGCTGG
TGCCGGCGGAGCTGCCGGCCGCCGCCGGCCTCTCTCGCTTCCACGCGGACGCCGCCGACGCGCCGCTGCTGTCCGTGGTGCGCTGGGCCTCGCGCGGCGC
CGCGCGCACGCGGCAACTGGCGCTGAGCCGCGACCGGCGGCGGCTGCTGGAGCTGCAGCGCGTGGAGGACGCGCGCAGCTGGTTCGTGGGCGGCCGCGTG
CTGCAGAGCGGCGCGCTCACGCTCTTCTCGCCGCTGGACGCGCTGTTCGTGCTGCTGGACGCGGCGTGGGCGCATCGCGCGCGCTTCTCGTCCCTCTACG
ACCTGCTGGCGCGCAGCGGCAACACGTGGCTGCTGCAGCTCGAGACGCTCACGCCCGAGGCCGTGGAGCGCCTGTGCGACGTGCAGCGCGTGGGCGGCGA
GCAAGAAGTGGACGACATGTACGTCAAGGCCAGCGAGGAGAAGGTTACGCGCTGGTTACGCGCCAAGGTGGAGCGCGCGGCTGCCGTGCTGGCCAATCAG
GAGGCGCAGGCCAACGCTATTATGGCTACACAGGCGGCGGCGGTGGAGAAGCAGGTGAATCTGCCTGGAGTGAAGAAGAAGAGTAACCAGGAGGGTACGC
AGGGGGTTACGCAGGAAGATGTGACGCGCCACTACCGACAAGCCATCGACGTGGTGGGGGACTACCTCCCCACTGAGTGGATCGACCTACTGTGCAAGGA
ATTCgggtaggtttgggtagagtggagggtagagtggggtagagtgaggtagagtggggtagTATGTTGATGCTCGGTGTTTTCTTCTTGTTGTGTAGGG
TAAAGAAGCAGGTGGAGGTGAAGGCGGCGCCCAAGGCGGCGGAGGGCGGACCACTGGACACGTTCAAGCGCTTCGATCGGCGCCAGACGCCGGAAAACAC
GGCCAAGCGCCCCACGCCCTCGAGCGCCGGGGCGGCCAAGAAGAAGAGCAAGCTGGCCAACGTGGATCGCACGGGCATGAAGTCGCTCACGTCCTTCTTC
GGCAAGAAGTAAGCGGGTGGGGGCAAGGTGGTGGATGCATTAAACCAATATATAGAGCTCTTTACCGCCGCGACGTGGAGCCCTCCACGCTTACCCGATG
CACTGCCACGAAGTCGTTCCAACCGGAGAGGATCCGGAACTTGACGAAGGACGCGTCGGTCGGCTTGACGTTCTCGCTCACGATCTGCAGCTCTCCGTCC
GACTCCTTCAACTCTGCAGGTGGACAGCACAACACGACACGTACAAGACAATTAGACAAGACGGACACAACAGTCGACACATTCAACCTTACTGGTATCG
AAGAGCTTCTCCCATTTAGTCGGCGTCGGCCCGCTGCAGGACTCCACAGACACCTCCTTGGCATTCCGCGTCCACATCTTGGCTCGTACAACGGAGGCCG
TCGTTGCAAGCTGAACCACGATCTCCTGCGGAAAACTCCCCGTCGTCACCCACTTGGACGATTGCTCTCTATCATACGCAAACGCAGCAAGCACGGAGCA
ATAAGGAACGCAGTTGCAAGTCCAGCGTAATAACTACAAGCTCACCCGTCCAAGATGTTGACCGGCGGGAAGTTCGAATCGAAAGACGTCACGGCAGTCA
CCTGGGCGCCCTCTTCATCCAAGGCAAGCTCCATCACGAACACAACGACTCCGGGCTTTTGTGAATATGCTTAGACCCTCCCTCCCGTTTCCTGAAGCCC
CTAGCAGAGGCTTAACTTAGAACAACCGCGGCATGACAAAACCAAGTAATAATAGGTGAAGGCACGCACTCATACTTATCATCTCGATTTTGCGCTGCGC
AGCGCACATGCACTGCGACTTACTTGAACACCCTCCTAGATACCAACGTCACAGATGGTCGCACGAATCCTTCGGCGCTGTTGATCACTTCCCGTGGCTT
CGATGCTCCCTCAGTGAAGTTTTTCAAGCGTCCAATCCACGCCACTGTCGACATCCTTCTCACGAGGACAGAGGCCGCTGAATGGACTCTTTGTACAGAC
GCTCGAAACCCGCGGACAGGATGTCGGCCGCACGCGTAATCCCCGATCCATCGTCATTGAAAAGCTTGCAGTTCGACCACATCAGACGGATATCGTTGGC
GAAGTGCGTGGAGTCCAGTTCCTTCACACCAGCAGCGACAGTGTTGCTGTCCACGACGTACGCGCCCTTCTTTAGTTTATTCTCGATCTTCGACAAATCC
ATCGGCTGCTTCACCACCCGCGTGTAGAGCGGCACATTTTCCACAGGCGTGAGGAACGGCTTGGAAAACGGATGCGACTTTAAGCACTCGACAACCTTCA
GGCACCTATCCAGCAAACTCTGCTCTGCAGCCACAGCAACGGAGTAGGCGTCGAACCGCGAAGGTTTCTTGCACTCGTCACACTGCCAATCACCCTCAGG
CAAGTCGTTCTCCGTCATGTGCAGACACTTCAAGTGGTAAGAGCGCGGGCACTTATCGCAGCATACCAGGTCACCAGCGCGTTGGCAAACCTCACAGAAA
TCTAGGTTGGCGTCCAACTCACTGTCCGAACcgtcttcgtcttcatcttggtcttcgtcatcttcgttgtaggcctcatcctctgtgtcatcgtcgtcat
TCTGCGCGCGCTTGAGGCGTTTAAAAGCACGTCTACCACGGCCTCTGCCCCTACCTCTTCCTCTGGCCTTCGGGGGCGGGGAAGTCTTACGATCTTGTGG
GATCTTCTTCTCCACGCGTGGCATAGCGGGGGTCCCATCCTTACGTGGACGTCCTGGTCCACGACGCATCGGTTGCGGTTGCAGTTGCGATGTCTGAATA
ACATGATGCTCCTTTTCAGCCTTGGGCGCACTTTCCCTTTCATGATCGTTTCGCTTTGTACTCAGCAACGATCTCGGCTCAGATCCATACCGGTTCTTGG
GTTCATTATCTTCTTCAGTTCCGGAATCTTCAGCGCGATGTGATGCCCTCGAATAATCTCGTGATTCCACGTCGTCCGATTCGCGTGGGGCAGCACTGTC
TTCGCCATCGCTATCGCTAGCACTAGCATCATGCTTCCGCGGTTCACTTTTTTCGCCGTCGCTGTCGCTTGCTTTCCGCTTCCGTGCCAGATTCGCCTCA
CCAGGCCGTGCACCCTGTGAACGCTCACGGGGAGTGCTATCACCTGAGTCCACTGAGCTGGTGGATGATTGATCTTGGTAAGAGCTATCCGTTTGACGAC
GCCTGTCAGCGATGCCGCGACCAGCATACACCCGAGGTGTTGTTCCCGCTTCCGCCTCGCCCGAAACTTGCGCATTCTCGCTATTTCCGTTTCCATCAGC
AATTCCATTCGTACCGTGGCGCGAATCACTCTGGGGGTGGCTGCTGTCTTTGCTGGACTGGCTGCTGGCGTCCATCGCCGTCGAAGTCTTGGGAGTTCCA
TTTTGATGCAACGAGCTTAAAAGTCGAACTAGAGATTGCTCCGACTCGGCACAATTGATAACAGTAGTCGCTGGCGGAGAATCCACGGAGGTTGGGTGAA
CACGTGGCGAAGCAACTCTAGGACCAACTCGGGAATCAGTGGCTTGCGCACTATCAGCCATTACAGAGAGCATATCAGCAGGGGTATCCTTGGCTGCTCG
CTTCGGAATGGGAGGATACTGCGACGGAGTCTTCTGCTGCGCCTGCATGCTGGGATATTCATCACGACTATTTCGTTCATCTTTCGGACGTTGTTCATAC
TCGGACTGCTGAGGCTGCATGTGTCGACGCCCTTCGAATGTTTTTCCTGGCTCCGTGGTTCGAGCAGAAAAGCCGTCGCGCCGAATAGGAGGACGGCCTT
CTGCCGATGAAGTGGGAGGGTACTGTGCGTACCGACGACCGTCGCTCGTCCCCATGCTTTGAGCACTAGCGTACGCCATTCGCCCCTCGGGTGTTGGCGC
TGAGACGACGGTGGACGTGGCAGCAGCAGTGGGGGCAGCAATAGCGCGGTCGCCCTTCATTGCAGGTGTTGAGCCTTGTCCACTGCGACGAAGTGTATCC
AGCAGATATCGCTTGTATTTCTGAACTTCCTTCTCCTTTCCTGCAGTGCAACCAGTGCACGGGCATCCGTGGGTGCAAATCAAGCAGCGCAGCAAGCGTC
GGTTGGGTGCGGATCCGTTCCGGCCGACGAACAACGCCTCCATCCTCACTCTGTAAACACTGCGTAAATGCTCACGACACAGCGAATGGTTCTCATCTGC
GTGCGGGCAAAAGTTCACCACCGGGACGAAGTGGTTCTCGCTGATACCGCACAAGTGACACAGTCCCTTCGCCACAAAGTTGGCTTCCTTTTCCGGGATC
AAGTCTTCCATCGCCACTGCGAACGCGTCGTGCAGCACCGACTCGTCCAGACTCACTTGCTCGCGGAGCATCTCCTCCACCCTCGGGGGCAGCTTCCTCT
CCCGCTTGTAATCCTCCGCCAACTTCCCGGACGAGCCTTCCTTCGTTCTACCCTGATACATGTTACCAGCCGAGCCGTCCACGACTCGCCCCTGGTAGCC
TGCTGGGACCTGAACCACCCTGCCCTGGTAACCTGTAGCTGCTTCCGGCGGTCTCGCTGGGTACCCCGGTCTGGGCTCGTTCGTTCTACCCTGGTACCCC
GGCGCTCCATCACTCGGTCTACCCTGGTATCCCGCAGGAGCTTCGCTCGTTCTGACCTGGTACCCCGGCGTTCCATCACTCGGTCTACCCTGGTATCCCG
CAGGTGCTTCGCTCGTTCTGACCTGGTATCCTGGCGGAGCATCGCTCATTCTACCTTGAGGCCCTGGCGGTCCATCGCCCATTCTACCTTGGTAGGCCGC
CGGTCTCCCCTGGTATCCAGCCGCTCTTTCGGGCATTCTACCTTGGTATCCCGCCGCTTCCATCGTCGTTCTCCCCTGGTAGGTCGGCGCTGCGTCGTTC
ACTCTCGCCTGATACTGCATCGTTCTACCTTGGGGGTACGGGGTAGGGCCCTCCACGGGGGGTCTCCCCTTGTACCCATCCACGGCTCTGGCGGGGTACC
CCGTCGCCTTCTCGGGCATTCTCCCTTGGTACCCAGCGGGAGCTTCGGCCGCCCTCCCCTGGTAGGGCGTGGGGCGTTCTCCCGCCCTCCCAGCGTACGC
AGCAGCGTACTGCTGGTACTGCAcgggcccctgcggggccgccgaggccggtggggggccctcccagtcgggcgacggcctggcgcggccctgccaggcg
gcgcccgagggcggcgcggcgcTCACAGCCGCGTTGTAGCCATCTTGTGCCTTGTAGCCATCTTGTGCCTTGCCCTTGCTCATGATGGCTTCCATCCACA
CTTCGTTGGGCGGGGGCGTGAGTCGCTGGCGCTGGGAGGAACCGTGGAAGTTTGTGCGCGGAGATAAGGTTAGAGAGGGAGGGGGCGGGGGGTATAAAGA
CTCAGGGGGGGAAGAAGACGCACCTTGTCCCCGCGGTCCCGAGGCGCCCCATGGTACATTCTGGCCGCTGGCTGCGTGGCGCTCGCTTCCTGGCTGAGGC
GTCAGCCGCTTGTCCGGCCCAAGGCTTCTTGAGATTTGTTAGCACTGCGAGTCGTGGGTTTGGCGCCGCTGCGGTCCGTGAGAGTTTATAATTTACCTTG
GAGAGTTGATACACGGTGAAAACGGATGTGAATGCGGTGTAGAGGATGCGTTTGTGGAGGTACCCATCGCACTCGGTGCC