Description :
From Genome Similarity Track
Location :
contig_124:17642- 22930
Transcript NameFunction/comments
g14021.t1hypothetical protein
g14022.t1hypothetical protein

Sequence
5288 bases(100 bases per row)
GGACCGCGGTGGAGGTTTCTGCGAGGTGCACCGTCGTGGTCGCCTCTGCAAGGTCGAGGGCTGCAAGAAGCTGTCCCGCAACCAGGGCATGTGCACCATG
CACATCCGCGAGGAGAAGCAGGACTCAACCAACTTCGATGCTCCCATGAAGGCCGAGTCTGCTGTCGCTCTGGCTGTCTAAGGATGATCGTTGCCAGATC
TCCTATTCTCGATCCTGGAATCCCGTTCTTCCCTCTCTACAATCTCCGCGTCTTCGTCGTCCCTCATTCAAAGGAAGATGAGGAGGGGAAGAACCAGAAG
TCGATGTCCGACAACTCGAGCTGTCGTCTATCGCTCGAGTTTATCTGTCTCTATGTCTCCAGTTTGTATTCATCGGCGTTCGTGCCAACCAGTTTAGTCT
ACGTGAAAGCCTCTGTCTCCGTGAAGTGTCCAGTATTTAACTCGTAATGCGCGATGAATGTATGAACCTGTCGACCCAAGCATTTCTTGACTTTGCCTCA
CGTTTCCTCCACACCTTGCAGCACCTCGACATTTTCTATCTGTTTACGTCGCGTCGATGACGGCCATTCAAGGCAACGAAAATGCGGTCGCCAGGAGCAG
CGGCGAGCATTGCAGATGTTGGTCGTTCTCGTGGAAAGCCCCGTTGGCCGCTTCAAGCAATGGTGCCAAGCTCTCCCACGCTGCCAAAGAAGCGCTCGAA
CACTCTGTCCTACCCTGCTGTATGGCTTGGCGATGGTTGCATGCCCAACAGCCGACACCGATTGGAATAGAGCACAATGCCGATTGCACAACCTCATAAT
ACTTGCATTGGTTTGTTTACGATAAGTGTCGGTCAGACAGTAAGTACATGCTCCGTGGGCTTCGACGACGCTTATGGCACGCCCCCGGACAAAACGGCAC
TGGTCTTGGGCGACATTGAAGCTGTGGATGACACCTCGTCCATATCGTCGTCCTGCGGGATCTCCAGGTGAAGCACCCGAGCGTGGTGAATTTGACGAAT
CGGCTGCGGGTGGTCGATCTGCGGCGGCATGGCTGTCCGGTGCGGGTGCGCGGCCTTGCCATGGGTGACGTGGCTGTGGTGGCCCTGCGGCAGCTTGGCA
CTATGGTGCATCTTGCCGTGCGGCGCCTTGGGCTCCTGCTTGGGCTCCACGGGCTTCACCGGGTTCTTCGCTGGCGAGAATTTCGAGTACAACCCGATCA
TCTCCTTCTTCATTTTGGCCTGGTACTTGCTGTGCTCACGGCAGTACTCGGTCGTGAAGTTTGCAATGTGCGAGAGCAGCACGTCCAGCTCCTCCTCGGT
GTCCTCTTCCTCGAAGTACTCGAGGAAGTGCGCCTTGGCCGCGTTCAACTTGTCTAACAGACCCTGCAGAACAGAGAGCTCCGTCTCCACTTCCTTGCAA
AACTGCTTCAACGTGTTCTTAGAAGTCGCCATCGCGTCCTTGTCGGCGTCGCTAGCAGTAGGACTCGGTACTGTAGCCTCAGCCTCGCGCAAAAGCTTCT
GCCATCCCGCCTCGAGTCCATTCTTTTCCGACGCAAGCGATGCGTACGCCACCTTGCTGCACTTGGAAATGAGGTCGATGTCATTGTAGAAGTGTGCAAG
ATGGGGCACGTCGCGCTCAATCGATTGCACCACATACTGCAAAAAGGTGATGCCACCCACGAAAGCCTTCGTTTGCGAAAACTTGACCAGGGAGCCCAGC
GAGAAGGCGTCGACGCCTTGATGTTCGTCATCGCCGCCAAAGTTGAGCAAGTTTCCAATCTGGAGAATATAAATAAATAGTTGGCGTAGTTCTGCGCTTG
AGCACACCTGGTACACGCCTCGGGTCACGAGGTCCAGCGACACGCGCAGCTCGTGCACGCGCGACGGGAACTCCTGCTTGAATACTAGACATCCCAGTTT
CTCCTGGAAGCGTGGCACACTGCGCACTTCCACCAGAAACTGTTCGGCAGTGCCGATTGTTGACACATCGCCGTTGAAGGCGTTAATGGCCTCCATCTCC
TTTCGGTCGGGCCACATGTCCATGAGAGACCGCACTTGCGAAGTCGAAAGCACCGTCGAGTTCATCGCCAAAATCTCGCGCTTGAGCTCGGGGAAGGGCA
TTTTTACGCGTGCCAGCGTGATGGCGATGTTCTGCGATTTCTTCATATCGATGAGCTGGACCATCGCCTTCTTCTTCTTGGCGGCAGCACCCTCAGATTT
CACGGTGGCAGTGCGCTTCTTGCTCTCCGTAAGATCCTTCACGAACAACTTCTCGAGCATAGCACGGCTCTCCTCGGAAATCTGAACCTGCTCCTTCGCC
TCCTCCACGGTATCGCCACCCCACAGACTGTCGCGACGCGTCCGGTGTTTCTTCCCTTCCCAGTGCAGCTTCTTGCGGATCGAGTCTTTGCGTTTCAGCG
TTTTCCGCTGCGGTTCCTCAACAGGAGCGGCAGCACTCCGAGGACCGTTCAGCTCCGCCGGGTCGAGTCCCGCCAACCGCATCTTTTGCTCGACCGCGCC
GCGCGGCAAGCCCATTCGAAGCATCTGGAAGTACTTGTGGTATTTCTTGCGGTGGGCGACTCTTTCCTCTTCCGAGATCTCCGACGCAGCTGCGGGCTTC
GGCTCCGGCCTCTTCGGTGGCCCCTGCAGCCATGCCGGGTCCACACCGTCCATGCGCATCTTGTGCTCCACAACCGACGGAGGAAGACCCACCTTCACCA
TCTGCGAGTACTTGCCGTGTCTCGCCTCGTACTCCTTCAGCTGTGCCTGGTACGCTGCCTCGGCTTCTGCGTCGAGAGCGGGTGCAGGTGTCTCCGGCAG
GGGCTTGTTCGGGTCCATGTCCAGAATGGTCGGGTCCACGTTCTCACTCTGCATCTTGTGCTTCACAACAGGAGCGGGGAGCCCCACCTTCAGCATCGTG
AAGTACTTTTGATACGTTGGGTGATCTTTCAGCGGGGTTTGGTCACCACCAGCTGCGGGTGAGGGCGTGGCAGCTCCTGCTGTTGCTGCAACAGGTGCTG
GCTGGATCGCTTGGCGCTGCTTCAACATCGCAGCCAATGGATGTGCGGCCCCGCTCGTTTCCTCCTGTGCAACCGCTGGTGCCGGTGGGGGCGATGGCGC
CGCTCTCCTCGCTAGCATGGCCTCCAATGGATTAATCTTGTTGGTCTGGGTGGGCTCATCGTCCGAGGCTGCGGGCGGCGGTGAAGATCGCTTCGCAAGC
ATGGCTTCCAGTGCGTTGTTCTGGCTGGCTGGCACCTTCTCCGGGTCAACGCTATCCGTTGGCGGAGCAACTCGCTTTGCAAGCATCTCAGCCAGCATGT
TACTTCTAGGTGCAATGGGCTCGGAGATCTCCCGAGAGTCCTCTTCGGGTCTTGATACTGGAGGTTCCTGTCCCTCCTCATCGGCCTCGTCCGGCTGGGA
GAGTACGCGATTGACGAGCATATCCGCTACACTAGCGTGTCTGTCGACACCCGCGGGCATATGCCGCTGCGAGAGCATTTCCAGCAGCCCCCCACCAAAA
AAGTCCTCGCTGTTATTTCTTGACCTTGCCGGGACGAGTACATGGAGTCGAGGTCGTCCATCTGATTGTCGCTGTCCTCGTCATCGAGTCTCACGTCGGC
CAGGAAGTCGAACGAATCGTATCTCCTACGCTCTTTCTTCTTCTTCTGGGGGGTTCTTTCCACGGGTTCTTCGTCGGGCTGTTCCTCCTCGGCCTGTTGC
CTCGCCAGCAGCTCCTCGAGCGCGCTCTGTAATCGGCCACGGCCTCTTACTGCACCTGTCAGTTCCTGCTGGTTGTCTTCAGAAGACGTGGAGGAGGTCG
CGGAGGACCCCCGACTCTCCGGTGCATTCCGGTCCACGAGCTCCCGCACATCGATCGCCTTGTCGTCGTTCTGTGCGGCTTTCTCGTCCTCGGCGGCGCT
GCCGCTATTGTTGCGGACGTCCCCGCCGTTGGGACTGGTGGACGTCGTGTGCCGGAAGAAGTCCTGCACCTTTTGCCGGTCGTTCCAATGTGTGGAAGTA
GCTGTGTGTGTGGAGGTGGCGGTTGCTGTACTGGTGGTTGCGGCCGTCTGCGGCTGGCCGAAGGGCGTGCGCTGGAAGCCGCTCATGGGCAGGCCGAACT
GCAGCCCCTCGGCGCGGGCCGACGGGCCCCGCCCCAGGTGCGGCAGCGAGGGCTCCGCTGCCGAGGCCGGACTGCGCTTGTCGGCGCCCATGAGCATGGA
GATAAAGGACGGTGCCATCTTCACCTAAGCGGCCACGAACGCTCCGAGAGAAAGACTGCGGAGAGGACCGCGAGAACAAAATCGAGTCCAGCAAATCGGG
TCGGCCAGACGACGAGGGCAGCCAACAGACAAGACAGAGTGGTGCTTCTCCTCTTGCAAAGTGCCTTTGCCTTTTGCCTTTGATGCCAACGGATTTCGAG
CTCGGCGGTCCTTCAGGTGTCTAGAAACGACACACAAAGGGTGCCACTGTTGAGCAGCTGGGGTCGAGTGAATGAAGAGTGGCCGCAATATGCTGTTTAG
AAGTTACGGTAAATGGGGCATCTCTGTTCGAGACGGGTACCTCCATCCATTCTGTTTGGAAGGTTAATACACTATATGAGTGTCGAGCTGTGTCAACTGG
CAAAATAATTTTCCATACTGGAATCAAGTCACTTGGAAACGGCCGAGTTTTTCAACTCGGAGTTTGGACTTATGAGCCAGGAAATGGCCAGTGAGAATCA
CTTACACCTTGACTTTGACTACGCTCAGCTGAGCCTCAGCCGGTGTCTACAGCTCTACACACCCCGCGGCTGAGCCACGACCAGCTAGGCCAAACAAAAA
GGCCACTTTTTTCGTTGCCTGGCCTGGTGGTGTGACAAGCGGCGCTGGCCAAGTGGCTGCTGCGGGCCCCACATGAACAGCCCTTCAGAAAGCGAAGGCG
ACAATCGCTACTCGACGACAATGGCGAGCAACAAGCCTTGCGCCAGTGCCGCTGGCTTGCCCGGAACTCGCCGAGCACGGGCCGTAGGCACGCACACCAA
GAGATGTGGCTCGCACTTGATATTTGTATGCAATACCGTTGTTTCTCTGACTTTGATACATCTCTTTTAGAACTGCGAAATATGATTTTTGGATAAAGTG
AAAACCATTCATTTTGACGGCTAAACAAAATATTCCTCTGATATCCGATGCAAAGAATTTGATTAAAACATAGTTCTCCGCGTGGTGGACCATATTGCGT
ATTTATTGAACCTTCTGGCTGTCTCGTCTGCATGTGTACGGTCCACTTTCCTCTCCAAGCACATACGGCCCGCCAAAGAGCATAAGCG